From a6ce65e7cb319266f3ea6d0336231ba195cf26ba Mon Sep 17 00:00:00 2001
From: Peter Siket <peter.siket@huawei.com>
Date: Tue, 10 Oct 2023 08:58:47 +0200
Subject: [PATCH] Implement local classes.

Issue: #I8TF63
Internal issue: #13836

Change-Id: I6d2fef8b90c45622ecb91b951526db1505e350b0
Signed-off-by: Peter Siket <peter.siket@huawei.com>
---
 ets2panda/BUILD.gn                            |    1 +
 ets2panda/CMakeLists.txt                      |    1 +
 ets2panda/checker/ETSAnalyzer.cpp             |   24 +-
 ets2panda/checker/ETSAnalyzer.h               |    2 +
 ets2panda/checker/ETSchecker.cpp              |   16 +-
 ets2panda/checker/ETSchecker.h                |   24 +-
 ets2panda/checker/checkerContext.h            |    1 +
 ets2panda/checker/ets/function.cpp            |    7 +-
 ets2panda/checker/ets/helpers.cpp             |  114 +-
 ets2panda/checker/ets/object.cpp              |   16 +-
 ets2panda/checker/ets/typeCreation.cpp        |   14 +-
 ets2panda/compiler/base/lreference.cpp        |   18 +-
 ets2panda/compiler/core/ETSCompiler.cpp       |   11 +-
 ets2panda/compiler/core/ETSGen.cpp            |   61 +-
 ets2panda/compiler/core/ETSGen.h              |   11 +-
 .../lowering/ets/localClassLowering.cpp       |  279 +
 .../lowering/ets/localClassLowering.h         |   50 +
 ets2panda/compiler/lowering/phase.cpp         |    3 +
 ets2panda/ir/base/classDefinition.cpp         |    3 +
 ets2panda/ir/base/classDefinition.h           |   71 +-
 .../ir/ets/etsNewClassInstanceExpression.h    |    5 +
 ets2panda/parser/ETSparser.cpp                |   29 +-
 ets2panda/parser/statementParser.cpp          |   12 +
 .../ets/identifierReference1-expected.txt     | 1967 +---
 .../ets/identifierReference15-expected.txt    |  893 +-
 .../ets/identifierReference16-expected.txt    | 1397 +--
 .../ets/identifierReference6-expected.txt     |  576 +-
 .../ets/identifierReference7-expected.txt     |  830 +-
 .../ets/invalidInheritance2-expected.txt      |  751 +-
 .../ets/invalidPrivateAccess5-expected.txt    | 1010 +-
 .../ets/invalidPrivateAccess6-expected.txt    | 1539 +--
 .../test/compiler/ets/override13-expected.txt |    2 +-
 ...staticInitializerInInnerClass-expected.txt |  687 +-
 .../test/parser/ets/StringFasta-expected.txt  | 9691 +----------------
 ...terface_enum_only_top_level_4-expected.txt |  470 +-
 .../ets/class_property_access-expected.txt    |  786 +-
 .../parser/ets/declare_iface-expected.txt     |  128 +-
 .../import_recursive-expected.txt             |  211 +-
 .../subpackage_module_1-expected.txt          |  320 +-
 .../subpackage_module_1-expected.txt          |  292 +-
 .../test/parser/ets/interfaces-expected.txt   |  128 +-
 ...class-access-modifier-private-expected.txt |    1 +
 .../local-class-access-modifier-private.ets   |   22 +
 ...ass-access-modifier-protected-expected.txt |    1 +
 .../local-class-access-modifier-protected.ets |   21 +
 ...-class-access-modifier-public-expected.txt |    1 +
 .../local-class-access-modifier-public.ets    |   21 +
 .../test/parser/ets/local-class-expected.txt  |  425 +
 ...mber-access-modifier-private1-expected.txt |    1 +
 ...-class-member-access-modifier-private1.ets |   22 +
 ...mber-access-modifier-private2-expected.txt |    1 +
 ...-class-member-access-modifier-private2.ets |   22 +
 ...er-access-modifier-protected1-expected.txt |    1 +
 ...lass-member-access-modifier-protected1.ets |   22 +
 ...er-access-modifier-protected2-expected.txt |    1 +
 ...lass-member-access-modifier-protected2.ets |   22 +
 ...ember-access-modifier-public1-expected.txt |    1 +
 ...l-class-member-access-modifier-public1.ets |   22 +
 ...ember-access-modifier-public2-expected.txt |    1 +
 ...l-class-member-access-modifier-public2.ets |   22 +
 ets2panda/test/parser/ets/local-class.ets     |   20 +
 ...rface-access-modifier-private-expected.txt |    1 +
 ...ocal-interface-access-modifier-private.ets |   21 +
 ...ace-access-modifier-protected-expected.txt |    1 +
 ...al-interface-access-modifier-protected.ets |   21 +
 ...erface-access-modifier-public-expected.txt |    1 +
 ...local-interface-access-modifier-public.ets |   21 +
 .../parser/ets/local-interface-expected.txt   |  331 +
 ...mber-access-modifier-private1-expected.txt |    1 +
 ...erface-member-access-modifier-private1.ets |   22 +
 ...mber-access-modifier-private2-expected.txt |    1 +
 ...erface-member-access-modifier-private2.ets |   22 +
 ...er-access-modifier-protected1-expected.txt |    1 +
 ...face-member-access-modifier-protected1.ets |   22 +
 ...er-access-modifier-protected2-expected.txt |    1 +
 ...face-member-access-modifier-protected2.ets |   22 +
 ...ember-access-modifier-public1-expected.txt |    1 +
 ...terface-member-access-modifier-public1.ets |   22 +
 ...ember-access-modifier-public2-expected.txt |    1 +
 ...terface-member-access-modifier-public2.ets |   22 +
 ets2panda/test/parser/ets/local-interface.ets |   20 +
 .../ets/localClassIsPermitted-expected.txt    |  501 +-
 .../test/parser/ets/named_types-expected.txt  | 1087 +-
 .../ets/null-coalesc-negative-expected.txt    |  166 +-
 .../parser/ets/test_interface-expected.txt    |  128 +-
 ...mbda_in_body_capture_variable-expected.txt |  595 +
 .../ets/local-class-capture-boxing.ets        |  218 +
 .../ets/local-class-capture-not-boxing.ets    |  151 +
 .../ets/local-class-capture-parameter.ets     |   39 +
 .../ets/local-class-in-local-class.ets        |   54 +
 .../runtime/ets/local-class-mixed-capture.ets |   46 +
 .../local-class-modify-captured-parameter.ets |   41 +
 .../ets/local-class-standard-example1.ets     |   49 +
 .../ets/local-class-standard-example2.ets     |   82 +
 .../ets-runtime/ets-runtime-ignored.txt       |    4 +
 ets2panda/varbinder/ETSBinder.cpp             |    2 +-
 ets2panda/varbinder/recordTable.cpp           |   20 +-
 ets2panda/varbinder/recordTable.h             |    3 +-
 ets2panda/varbinder/scope.cpp                 |   80 +-
 ets2panda/varbinder/scope.h                   |    3 +
 100 files changed, 5452 insertions(+), 21473 deletions(-)
 create mode 100644 ets2panda/compiler/lowering/ets/localClassLowering.cpp
 create mode 100644 ets2panda/compiler/lowering/ets/localClassLowering.h
 create mode 100644 ets2panda/test/parser/ets/local-class-access-modifier-private-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-class-access-modifier-private.ets
 create mode 100644 ets2panda/test/parser/ets/local-class-access-modifier-protected-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-class-access-modifier-protected.ets
 create mode 100644 ets2panda/test/parser/ets/local-class-access-modifier-public-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-class-access-modifier-public.ets
 create mode 100644 ets2panda/test/parser/ets/local-class-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-private1-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-private1.ets
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-private2-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-private2.ets
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-protected1-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-protected1.ets
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-protected2-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-protected2.ets
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-public1-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-public1.ets
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-public2-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-class-member-access-modifier-public2.ets
 create mode 100644 ets2panda/test/parser/ets/local-class.ets
 create mode 100644 ets2panda/test/parser/ets/local-interface-access-modifier-private-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-interface-access-modifier-private.ets
 create mode 100644 ets2panda/test/parser/ets/local-interface-access-modifier-protected-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-interface-access-modifier-protected.ets
 create mode 100644 ets2panda/test/parser/ets/local-interface-access-modifier-public-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-interface-access-modifier-public.ets
 create mode 100644 ets2panda/test/parser/ets/local-interface-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-private1-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-private1.ets
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-private2-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-private2.ets
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-protected1-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-protected1.ets
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-protected2-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-protected2.ets
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-public1-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-public1.ets
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-public2-expected.txt
 create mode 100644 ets2panda/test/parser/ets/local-interface-member-access-modifier-public2.ets
 create mode 100644 ets2panda/test/parser/ets/local-interface.ets
 create mode 100644 ets2panda/test/runtime/ets/local-class-capture-boxing.ets
 create mode 100644 ets2panda/test/runtime/ets/local-class-capture-not-boxing.ets
 create mode 100644 ets2panda/test/runtime/ets/local-class-capture-parameter.ets
 create mode 100644 ets2panda/test/runtime/ets/local-class-in-local-class.ets
 create mode 100644 ets2panda/test/runtime/ets/local-class-mixed-capture.ets
 create mode 100644 ets2panda/test/runtime/ets/local-class-modify-captured-parameter.ets
 create mode 100644 ets2panda/test/runtime/ets/local-class-standard-example1.ets
 create mode 100644 ets2panda/test/runtime/ets/local-class-standard-example2.ets

diff --git a/ets2panda/BUILD.gn b/ets2panda/BUILD.gn
index f80821e40e..75c8be3212 100644
--- a/ets2panda/BUILD.gn
+++ b/ets2panda/BUILD.gn
@@ -164,6 +164,7 @@ libes2panda_sources = [
   "compiler/lowering/ets/generateDeclarations.cpp",
   "compiler/lowering/ets/interfacePropertyDeclarations.cpp",
   "compiler/lowering/ets/lambdaLowering.cpp",
+  "compiler/lowering/ets/localClassLowering.cpp",
   "compiler/lowering/ets/objectIndexAccess.cpp",
   "compiler/lowering/ets/objectIterator.cpp",
   "compiler/lowering/ets/opAssignment.cpp",
diff --git a/ets2panda/CMakeLists.txt b/ets2panda/CMakeLists.txt
index 386212ba63..668fbc3046 100644
--- a/ets2panda/CMakeLists.txt
+++ b/ets2panda/CMakeLists.txt
@@ -151,6 +151,7 @@ set(ES2PANDA_LIB_SRC
   compiler/lowering/plugin_phase.cpp
   compiler/lowering/util.cpp
   compiler/lowering/ets/lambdaLowering.cpp
+  compiler/lowering/ets/localClassLowering.cpp
   compiler/lowering/ets/generateDeclarations.cpp
   compiler/lowering/ets/objectIndexAccess.cpp
   compiler/lowering/ets/objectIterator.cpp
diff --git a/ets2panda/checker/ETSAnalyzer.cpp b/ets2panda/checker/ETSAnalyzer.cpp
index 7917598b0e..ac0de8bc56 100644
--- a/ets2panda/checker/ETSAnalyzer.cpp
+++ b/ets2panda/checker/ETSAnalyzer.cpp
@@ -555,13 +555,18 @@ checker::Type *ETSAnalyzer::Check(ir::ETSNewArrayInstanceExpression *expr) const
     return expr->TsType();
 }
 
-checker::Type *ETSAnalyzer::Check(ir::ETSNewClassInstanceExpression *expr) const
+void ETSAnalyzer::CheckLocalClassInstantiation(ir::ETSNewClassInstanceExpression *expr, ETSObjectType *calleeObj) const
 {
     ETSChecker *checker = GetETSChecker();
-    auto *calleeType = GetCalleeType(checker, expr);
-    auto *calleeObj = calleeType->AsETSObjectType();
-    expr->SetTsType(calleeObj);
+    ASSERT(calleeObj->GetDeclNode()->IsClassDefinition());
+    if (calleeObj->GetDeclNode()->AsClassDefinition()->IsLocal()) {
+        checker->AddToLocalClassInstantiationList(expr);
+    }
+}
 
+void ETSAnalyzer::CheckInstantatedClass(ir::ETSNewClassInstanceExpression *expr, ETSObjectType *&calleeObj) const
+{
+    ETSChecker *checker = GetETSChecker();
     if (expr->ClassDefinition() != nullptr) {
         if (!calleeObj->HasObjectFlag(checker::ETSObjectFlags::ABSTRACT) && calleeObj->GetDeclNode()->IsFinal()) {
             checker->ThrowTypeError({"Class ", calleeObj->Name(), " cannot be both 'abstract' and 'final'."},
@@ -582,6 +587,17 @@ checker::Type *ETSAnalyzer::Check(ir::ETSNewClassInstanceExpression *expr) const
     } else if (calleeObj->HasObjectFlag(checker::ETSObjectFlags::ABSTRACT)) {
         checker->ThrowTypeError({calleeObj->Name(), " is abstract therefore cannot be instantiated."}, expr->Start());
     }
+}
+
+checker::Type *ETSAnalyzer::Check(ir::ETSNewClassInstanceExpression *expr) const
+{
+    ETSChecker *checker = GetETSChecker();
+    auto *calleeType = GetCalleeType(checker, expr);
+    auto *calleeObj = calleeType->AsETSObjectType();
+    expr->SetTsType(calleeObj);
+
+    CheckLocalClassInstantiation(expr, calleeObj);
+    CheckInstantatedClass(expr, calleeObj);
 
     if (calleeType->IsETSDynamicType() && !calleeType->AsETSDynamicType()->HasDecl()) {
         auto lang = calleeType->AsETSDynamicType()->Language();
diff --git a/ets2panda/checker/ETSAnalyzer.h b/ets2panda/checker/ETSAnalyzer.h
index 4f63eeaed4..8350294baf 100644
--- a/ets2panda/checker/ETSAnalyzer.h
+++ b/ets2panda/checker/ETSAnalyzer.h
@@ -42,6 +42,8 @@ public:
 
 private:
     ETSChecker *GetETSChecker() const;
+    void CheckInstantatedClass(ir::ETSNewClassInstanceExpression *expr, ETSObjectType *&calleeObj) const;
+    void CheckLocalClassInstantiation(ir::ETSNewClassInstanceExpression *expr, ETSObjectType *calleeObj) const;
     void CheckMethodModifiers(ir::MethodDefinition *node) const;
     checker::Signature *ResolveSignature(ETSChecker *checker, ir::CallExpression *expr, checker::Type *calleeType,
                                          bool isFunctionalInterface, bool isUnionTypeWithFunctionalInterface) const;
diff --git a/ets2panda/checker/ETSchecker.cpp b/ets2panda/checker/ETSchecker.cpp
index 1968b6b553..29c64c2734 100644
--- a/ets2panda/checker/ETSchecker.cpp
+++ b/ets2panda/checker/ETSchecker.cpp
@@ -137,6 +137,21 @@ void ETSChecker::InitializeBuiltin(varbinder::Variable *var, const util::StringV
     GetGlobalTypesHolder()->InitializeBuiltin(name, type);
 }
 
+const ArenaList<ir::ClassDefinition *> &ETSChecker::GetLocalClasses() const
+{
+    return localClasses_;
+}
+
+const ArenaList<ir::ETSNewClassInstanceExpression *> &ETSChecker::GetLocalClassInstantiations() const
+{
+    return localClassInstantiations_;
+}
+
+void ETSChecker::AddToLocalClassInstantiationList(ir::ETSNewClassInstanceExpression *newExpr)
+{
+    localClassInstantiations_.push_back(newExpr);
+}
+
 bool ETSChecker::StartChecker([[maybe_unused]] varbinder::VarBinder *varbinder, const CompilerOptions &options)
 {
     Initialize(varbinder);
@@ -168,7 +183,6 @@ bool ETSChecker::StartChecker([[maybe_unused]] varbinder::VarBinder *varbinder,
     }
 
     CheckProgram(Program(), true);
-
     BuildDynamicCallClass(true);
     BuildDynamicCallClass(false);
 
diff --git a/ets2panda/checker/ETSchecker.h b/ets2panda/checker/ETSchecker.h
index 8c0b13990c..f401c4bdf1 100644
--- a/ets2panda/checker/ETSchecker.h
+++ b/ets2panda/checker/ETSchecker.h
@@ -61,6 +61,8 @@ public:
         // NOLINTNEXTLINE(readability-redundant-member-init)
         : Checker(),
           arrayTypes_(Allocator()->Adapter()),
+          localClasses_(Allocator()->Adapter()),
+          localClassInstantiations_(Allocator()->Adapter()),
           globalArraySignatures_(Allocator()->Adapter()),
           primitiveWrappers_(Allocator()),
           cachedComputedAbstracts_(Allocator()->Adapter()),
@@ -159,6 +161,7 @@ public:
     void AddImplementedSignature(std::vector<Signature *> *implementedSignatures, varbinder::LocalVariable *function,
                                  ETSFunctionType *it);
     void CheckInnerClassMembers(const ETSObjectType *classType);
+    void CheckLocalClass(ir::ClassDefinition *classDef, CheckerStatus &checkerStatus);
     void CheckClassDefinition(ir::ClassDefinition *classDef);
     void FindAssignment(const ir::AstNode *node, const varbinder::LocalVariable *classVar, bool &initialized);
     void FindAssignments(const ir::AstNode *node, const varbinder::LocalVariable *classVar, bool &initialized);
@@ -506,11 +509,13 @@ public:
     std::pair<const varbinder::Variable *, const ETSObjectType *> FindVariableInClassOrEnclosing(
         util::StringView name, const ETSObjectType *classType);
     varbinder::Variable *FindVariableInGlobal(const ir::Identifier *identifier);
+    void ExtraCheckForResolvedError(ir::Identifier *ident);
     void ValidateResolvedIdentifier(ir::Identifier *ident, varbinder::Variable *resolved);
     static bool IsVariableStatic(const varbinder::Variable *var);
     static bool IsVariableGetterSetter(const varbinder::Variable *var);
     bool IsSameDeclarationType(varbinder::LocalVariable *target, varbinder::LocalVariable *compare);
-    void SaveCapturedVariable(varbinder::Variable *var, const lexer::SourcePosition &pos);
+    void SaveCapturedVariable(varbinder::Variable *var, ir::Identifier *ident);
+    bool SaveCapturedVariableInLocalClass(varbinder::Variable *var, ir::Identifier *ident);
     void AddBoxingFlagToPrimitiveType(TypeRelation *relation, Type *target);
     void AddUnboxingFlagToPrimitiveType(TypeRelation *relation, Type *source, Type *self);
     void CheckUnboxedTypeWidenable(TypeRelation *relation, Type *target, Type *self);
@@ -547,6 +552,7 @@ public:
     static ir::MethodDefinition *GenerateDefaultGetterSetter(ir::ClassProperty *field, varbinder::ClassScope *scope,
                                                              bool isSetter, ETSChecker *checker);
 
+    bool IsInLocalClass(const ir::AstNode *node) const;
     // Exception
     ETSObjectType *CheckExceptionOrErrorType(checker::Type *type, lexer::SourcePosition pos);
 
@@ -606,6 +612,12 @@ public:
 
     ETSObjectType *GetCachedFunctionlInterface(ir::ETSFunctionType *type);
     void CacheFunctionalInterface(ir::ETSFunctionType *type, ETSObjectType *ifaceType);
+    const ArenaList<ir::ClassDefinition *> &GetLocalClasses() const;
+    const ArenaList<ir::ETSNewClassInstanceExpression *> &GetLocalClassInstantiations() const;
+    void AddToLocalClassInstantiationList(ir::ETSNewClassInstanceExpression *newExpr);
+
+    ir::ETSParameterExpression *AddParam(varbinder::FunctionParamScope *paramScope, util::StringView name,
+                                         checker::Type *type);
 
 private:
     using ClassBuilder = std::function<void(varbinder::ClassScope *, ArenaVector<ir::AstNode *> *)>;
@@ -615,9 +627,10 @@ private:
                                              ArenaVector<ir::Expression *> *, Type **)>;
 
     std::pair<const ir::Identifier *, ir::TypeNode *> GetTargetIdentifierAndType(ir::Identifier *ident);
-    void ThrowError(ir::Identifier *ident);
+    [[noreturn]] void ThrowError(ir::Identifier *ident);
     void CheckEtsFunctionType(ir::Identifier *ident, ir::Identifier const *id, ir::TypeNode const *annotation);
-    void NotResolvedError(ir::Identifier *ident);
+    [[noreturn]] void NotResolvedError(ir::Identifier *ident, const varbinder::Variable *classVar,
+                                       const ETSObjectType *classType);
     void ValidateCallExpressionIdentifier(ir::Identifier *ident, Type *type);
     void ValidateNewClassInstanceIdentifier(ir::Identifier *ident, varbinder::Variable *resolved);
     void ValidateMemberIdentifier(ir::Identifier *ident, varbinder::Variable *resolved, Type *type);
@@ -643,9 +656,6 @@ private:
     std::conditional_t<IS_STATIC, ir::ClassStaticBlock *, ir::MethodDefinition *> CreateClassInitializer(
         varbinder::ClassScope *classScope, const ClassInitializerBuilder &builder, ETSObjectType *type = nullptr);
 
-    ir::ETSParameterExpression *AddParam(varbinder::FunctionParamScope *paramScope, util::StringView name,
-                                         checker::Type *type);
-
     template <bool IS_STATIC>
     ir::MethodDefinition *CreateClassMethod(varbinder::ClassScope *classScope, std::string_view name,
                                             ir::ModifierFlags modifierFlags, const MethodBuilder &builder);
@@ -711,6 +721,8 @@ private:
     bool TryTransformingToStaticInvoke(ir::Identifier *ident, const Type *resolvedType);
 
     ArrayMap arrayTypes_;
+    ArenaList<ir::ClassDefinition *> localClasses_;
+    ArenaList<ir::ETSNewClassInstanceExpression *> localClassInstantiations_;
     GlobalArraySignatureMap globalArraySignatures_;
     PrimitiveWrappers primitiveWrappers_;
     ComputedAbstracts cachedComputedAbstracts_;
diff --git a/ets2panda/checker/checkerContext.h b/ets2panda/checker/checkerContext.h
index 79c59a3fab..11ff0c4f3c 100644
--- a/ets2panda/checker/checkerContext.h
+++ b/ets2panda/checker/checkerContext.h
@@ -45,6 +45,7 @@ enum class CheckerStatus : uint32_t {
     IN_LAMBDA = 1U << 13U,
     IGNORE_VISIBILITY = 1U << 14U,
     IN_INSTANCE_EXTENSION_METHOD = 1U << 15U,
+    IN_LOCAL_CLASS = 1U << 16U
 };
 
 DEFINE_BITOPS(CheckerStatus)
diff --git a/ets2panda/checker/ets/function.cpp b/ets2panda/checker/ets/function.cpp
index 34473739d3..bb5d421349 100644
--- a/ets2panda/checker/ets/function.cpp
+++ b/ets2panda/checker/ets/function.cpp
@@ -1308,7 +1308,9 @@ void ETSChecker::CheckCapturedVariable(ir::AstNode *const node, varbinder::Varia
 
 void ETSChecker::CheckCapturedVariableInSubnodes(ir::AstNode *node, varbinder::Variable *var)
 {
-    node->Iterate([this, var](ir::AstNode *childNode) { CheckCapturedVariable(childNode, var); });
+    if (!node->IsClassDefinition()) {
+        node->Iterate([this, var](ir::AstNode *childNode) { CheckCapturedVariable(childNode, var); });
+    }
 }
 
 void ETSChecker::CheckCapturedVariables()
@@ -2110,13 +2112,14 @@ ir::ClassProperty *ETSChecker::CreateLambdaCapturedField(const varbinder::Variab
     auto fieldCtx = varbinder::LexicalScope<varbinder::LocalScope>::Enter(VarBinder(), scope->InstanceFieldScope());
 
     // Create the name for the synthetic property node
-    util::UString fieldName(util::StringView("field"), Allocator());
+    util::UString fieldName(util::StringView("field#"), Allocator());
     fieldName.Append(std::to_string(idx));
     auto *fieldIdent = Allocator()->New<ir::Identifier>(fieldName.View(), Allocator());
 
     // Create the synthetic class property node
     auto *field =
         Allocator()->New<ir::ClassProperty>(fieldIdent, nullptr, nullptr, ir::ModifierFlags::NONE, Allocator(), false);
+    fieldIdent->SetParent(field);
 
     // Add the declaration to the scope, and set the type based on the captured variable's scope
     auto [decl, var] = VarBinder()->NewVarDecl<varbinder::LetDecl>(pos, fieldIdent->Name());
diff --git a/ets2panda/checker/ets/helpers.cpp b/ets2panda/checker/ets/helpers.cpp
index a4e7677631..eb8f1a1d82 100644
--- a/ets2panda/checker/ets/helpers.cpp
+++ b/ets2panda/checker/ets/helpers.cpp
@@ -490,16 +490,16 @@ void ETSChecker::CheckEtsFunctionType(ir::Identifier *const ident, ir::Identifie
     }
 }
 
-void ETSChecker::NotResolvedError(ir::Identifier *const ident)
+void ETSChecker::NotResolvedError(ir::Identifier *const ident, const varbinder::Variable *classVar,
+                                  const ETSObjectType *classType)
 {
-    const auto [class_var, class_type] = FindVariableInClassOrEnclosing(ident->Name(), Context().ContainingClass());
-    if (class_var == nullptr) {
+    if (classVar == nullptr) {
         ThrowError(ident);
     }
 
-    if (IsVariableStatic(class_var)) {
+    if (IsVariableStatic(classVar)) {
         ThrowTypeError(
-            {"Static property '", ident->Name(), "' must be accessed through it's class '", class_type->Name(), "'"},
+            {"Static property '", ident->Name(), "' must be accessed through it's class '", classType->Name(), "'"},
             ident->Start());
     } else {
         ThrowTypeError({"Property '", ident->Name(), "' must be accessed through 'this'"}, ident->Start());
@@ -614,10 +614,25 @@ bool ETSChecker::ValidateBinaryExpressionIdentifier(ir::Identifier *const ident,
     return isFinished;
 }
 
+void ETSChecker::ExtraCheckForResolvedError(ir::Identifier *const ident)
+{
+    const auto [class_var, class_type] = FindVariableInClassOrEnclosing(ident->Name(), Context().ContainingClass());
+    auto *parentClass = FindAncestorGivenByType(ident, ir::AstNodeType::CLASS_DEFINITION);
+    if (parentClass != nullptr && parentClass->AsClassDefinition()->IsLocal()) {
+        if (parentClass != class_type->GetDeclNode()) {
+            ThrowTypeError({"Property '", ident->Name(), "' of enclosing class '", class_type->Name(),
+                            "' is not allowed to be captured from the local class '",
+                            parentClass->AsClassDefinition()->Ident()->Name(), "'"},
+                           ident->Start());
+        }
+    }
+    NotResolvedError(ident, class_var, class_type);
+}
+
 void ETSChecker::ValidateResolvedIdentifier(ir::Identifier *const ident, varbinder::Variable *const resolved)
 {
     if (resolved == nullptr) {
-        NotResolvedError(ident);
+        ExtraCheckForResolvedError(ident);
     }
 
     auto *const resolvedType = GetApparentType(GetTypeOfVariable(resolved));
@@ -667,8 +682,77 @@ void ETSChecker::ValidateResolvedIdentifier(ir::Identifier *const ident, varbind
     }
 }
 
-void ETSChecker::SaveCapturedVariable(varbinder::Variable *const var, const lexer::SourcePosition &pos)
+bool ETSChecker::SaveCapturedVariableInLocalClass(varbinder::Variable *const var, ir::Identifier *ident)
 {
+    const auto &pos = ident->Start();
+
+    if (!HasStatus(CheckerStatus::IN_LOCAL_CLASS)) {
+        return false;
+    }
+
+    if (!var->HasFlag(varbinder::VariableFlags::LOCAL)) {
+        return false;
+    }
+
+    LOG(DEBUG, ES2PANDA) << "Checking variable (line:" << pos.line << "): " << var->Name();
+    auto *scopeIter = Scope();
+    bool inStaticMethod = false;
+
+    auto captureVariable = [this, var, ident, &scopeIter, &inStaticMethod, &pos]() {
+        if (inStaticMethod) {
+            ThrowTypeError({"Not allowed to capture variable '", var->Name(), "' in static method"}, pos);
+        }
+        if (scopeIter->Node()->AsClassDefinition()->CaptureVariable(var)) {
+            LOG(DEBUG, ES2PANDA) << "  Captured in class:" << scopeIter->Node()->AsClassDefinition()->Ident()->Name();
+        }
+
+        auto *parent = ident->Parent();
+
+        if (parent->IsVariableDeclarator()) {
+            parent = parent->Parent()->Parent();
+        }
+
+        if (!(parent->IsUpdateExpression() ||
+              (parent->IsAssignmentExpression() && parent->AsAssignmentExpression()->Left() == ident)) ||
+            var->Declaration() == nullptr) {
+            return;
+        }
+
+        if (var->Declaration()->IsParameterDecl()) {
+            LOG(DEBUG, ES2PANDA) << "    - Modified parameter ";
+            if (!var->HasFlag(varbinder::VariableFlags::BOXED)) {
+                scopeIter->Node()->AsClassDefinition()->AddToLocalVariableIsNeeded(var);
+            }
+        } else {
+            var->AddFlag(varbinder::VariableFlags::BOXED);
+        }
+    };
+
+    while (scopeIter != var->GetScope()) {
+        if (scopeIter->Node() != nullptr) {
+            if (scopeIter->Node()->IsScriptFunction() && scopeIter->Node()->AsScriptFunction()->IsStatic()) {
+                inStaticMethod = true;
+            }
+
+            if (scopeIter->Node()->IsClassDefinition()) {
+                captureVariable();
+                return true;
+            }
+        }
+        scopeIter = scopeIter->Parent();
+    }
+
+    return false;
+}
+
+void ETSChecker::SaveCapturedVariable(varbinder::Variable *const var, ir::Identifier *ident)
+{
+    const auto &pos = ident->Start();
+
+    if (SaveCapturedVariableInLocalClass(var, ident)) {
+        return;
+    }
+
     if (!HasStatus(CheckerStatus::IN_LAMBDA)) {
         return;
     }
@@ -697,7 +781,7 @@ Type *ETSChecker::ResolveIdentifier(ir::Identifier *const ident)
 {
     if (ident->Variable() != nullptr) {
         auto *const resolved = ident->Variable();
-        SaveCapturedVariable(resolved, ident->Start());
+        SaveCapturedVariable(resolved, ident);
         return GetTypeOfVariable(resolved);
     }
 
@@ -711,7 +795,7 @@ Type *ETSChecker::ResolveIdentifier(ir::Identifier *const ident)
     ValidateResolvedIdentifier(ident, resolved);
 
     ValidatePropertyAccess(resolved, Context().ContainingClass(), ident->Start());
-    SaveCapturedVariable(resolved, ident->Start());
+    SaveCapturedVariable(resolved, ident);
 
     ident->SetVariable(resolved);
     return GetTypeOfVariable(resolved);
@@ -2618,6 +2702,18 @@ void ETSChecker::ModifyPreferredType(ir::ArrayExpression *const arrayExpr, Type
     }
 }
 
+bool ETSChecker::IsInLocalClass(const ir::AstNode *node) const
+{
+    while (node != nullptr) {
+        if (node->Type() == ir::AstNodeType::CLASS_DEFINITION) {
+            return node->AsClassDefinition()->IsLocal();
+        }
+        node = node->Parent();
+    }
+
+    return false;
+}
+
 ir::Expression *ETSChecker::GenerateImplicitInstantiateArg(varbinder::LocalVariable *instantiateMethod,
                                                            const std::string &className)
 {
diff --git a/ets2panda/checker/ets/object.cpp b/ets2panda/checker/ets/object.cpp
index d7c3f9dea3..82f9371201 100644
--- a/ets2panda/checker/ets/object.cpp
+++ b/ets2panda/checker/ets/object.cpp
@@ -814,12 +814,22 @@ void ETSChecker::AddImplementedSignature(std::vector<Signature *> *implementedSi
     }
 }
 
+void ETSChecker::CheckLocalClass(ir::ClassDefinition *classDef, CheckerStatus &checkerStatus)
+{
+    if (classDef->IsLocal()) {
+        checkerStatus |= CheckerStatus::IN_LOCAL_CLASS;
+        if (!classDef->Parent()->Parent()->IsBlockStatement()) {
+            ThrowTypeError("Local classes must be defined between balanced braces", classDef->Start());
+        }
+        localClasses_.push_back(classDef);
+    }
+}
+
 void ETSChecker::CheckClassDefinition(ir::ClassDefinition *classDef)
 {
     auto *classType = classDef->TsType()->AsETSObjectType();
-    auto *enclosingClass = Context().ContainingClass();
     auto newStatus = checker::CheckerStatus::IN_CLASS;
-    classType->SetEnclosingType(enclosingClass);
+    classType->SetEnclosingType(Context().ContainingClass());
 
     if (classDef->IsInner()) {
         newStatus |= CheckerStatus::INNER_CLASS;
@@ -828,6 +838,8 @@ void ETSChecker::CheckClassDefinition(ir::ClassDefinition *classDef)
 
     if (classDef->IsGlobal()) {
         classType->AddObjectFlag(checker::ETSObjectFlags::GLOBAL);
+    } else {
+        CheckLocalClass(classDef, newStatus);
     }
 
     checker::ScopeContext scopeCtx(this, classDef->Scope());
diff --git a/ets2panda/checker/ets/typeCreation.cpp b/ets2panda/checker/ets/typeCreation.cpp
index b02188e7a1..cf746be38b 100644
--- a/ets2panda/checker/ets/typeCreation.cpp
+++ b/ets2panda/checker/ets/typeCreation.cpp
@@ -25,6 +25,7 @@
 #include "checker/types/ets/shortType.h"
 #include "generated/signatures.h"
 #include "ir/base/classDefinition.h"
+#include "ir/statements/classDeclaration.h"
 #include "ir/base/scriptFunction.h"
 #include "ir/ets/etsScript.h"
 #include "ir/expressions/identifier.h"
@@ -499,6 +500,14 @@ ETSObjectType *ETSChecker::CreateNewETSObjectType(util::StringView name, ir::Ast
 
     auto *containingObjType = util::Helpers::GetContainingObjectType(declNode->Parent());
 
+    if (declNode->IsClassDefinition()) {
+        if (declNode->AsClassDefinition()->IsLocal()) {
+            util::UString localName(declNode->AsClassDefinition()->LocalPrefix(), Allocator());
+            localName.Append(name);
+            assemblerName = localName.View();
+        }
+    }
+
     if (containingObjType != nullptr) {
         prefix = containingObjType->AssemblerName();
     } else if (const auto *topStatement = declNode->GetTopStatement();
@@ -507,14 +516,13 @@ ETSObjectType *ETSChecker::CreateNewETSObjectType(util::StringView name, ir::Ast
         ASSERT(declNode->IsTSInterfaceDeclaration());
         assemblerName = declNode->AsTSInterfaceDeclaration()->InternalName();
     } else {
-        auto *program = static_cast<ir::ETSScript *>(declNode->GetTopStatement())->Program();
-        prefix = program->GetPackageName();
+        prefix = static_cast<ir::ETSScript *>(declNode->GetTopStatement())->Program()->GetPackageName();
     }
 
     if (!prefix.Empty()) {
         util::UString fullPath(prefix, Allocator());
         fullPath.Append('.');
-        fullPath.Append(name);
+        fullPath.Append(assemblerName);
         assemblerName = fullPath.View();
     }
 
diff --git a/ets2panda/compiler/base/lreference.cpp b/ets2panda/compiler/base/lreference.cpp
index 8b00d8c3c0..a047c992aa 100644
--- a/ets2panda/compiler/base/lreference.cpp
+++ b/ets2panda/compiler/base/lreference.cpp
@@ -1,5 +1,5 @@
 /*
- * Copyright (c) 2021 - 2023 Huawei Device Co., Ltd.
+ * Copyright (c) 2021 - 2024 Huawei Device Co., Ltd.
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
  * You may obtain a copy of the License at
@@ -208,14 +208,24 @@ ETSLReference::ETSLReference(CodeGen *cg, const ir::AstNode *node, ReferenceKind
 ETSLReference ETSLReference::Create(CodeGen *const cg, const ir::AstNode *const node, const bool isDeclaration)
 {
     if (node->Type() == ir::AstNodeType::IDENTIFIER) {
+        if (node->AsIdentifier()->Variable() != nullptr) {
+            auto *var = node->AsIdentifier()->Variable();
+            varbinder::ConstScopeFindResult res;
+            res.name = var->Name();
+            res.variable = var;
+            res.scope = var->GetScope();
+            auto refKind = ReferenceKind::VAR_OR_GLOBAL;
+            if (var->HasFlag(varbinder::VariableFlags::PROPERTY)) {
+                refKind = ReferenceKind::FIELD;
+            }
+            return {cg, node, refKind, res, isDeclaration};
+        }
+
         const auto &name = node->AsIdentifier()->Name();
         auto res = cg->Scope()->FindInFunctionScope(name, varbinder::ResolveBindingOptions::ALL);
         if (res.variable == nullptr) {
             res = cg->Scope()->FindInGlobal(name, varbinder::ResolveBindingOptions::ALL_VARIABLES |
                                                       varbinder::ResolveBindingOptions::ALL_METHOD);
-            if (res.variable == nullptr) {
-                res.variable = node->AsIdentifier()->Variable();
-            }
         }
 
         return {cg, node, ReferenceKind::VAR_OR_GLOBAL, res, isDeclaration};
diff --git a/ets2panda/compiler/core/ETSCompiler.cpp b/ets2panda/compiler/core/ETSCompiler.cpp
index e7c26b723e..eeb5b8624f 100644
--- a/ets2panda/compiler/core/ETSCompiler.cpp
+++ b/ets2panda/compiler/core/ETSCompiler.cpp
@@ -321,6 +321,7 @@ void ETSCompiler::Compile(const ir::ETSNewClassInstanceExpression *expr) const
 {
     ETSGen *etsg = GetETSGen();
     if (expr->TsType()->IsETSDynamicType()) {
+        compiler::RegScope rs(etsg);
         auto objReg = etsg->AllocReg();
         auto *name = expr->GetTypeRef()->AsETSTypeReference()->Part()->Name();
         CreateDynamicObject(expr, etsg, objReg, name, expr->signature_, expr->GetArguments());
@@ -1559,10 +1560,7 @@ void ETSCompiler::Compile(const ir::BreakStatement *st) const
     CompileImpl(st, etsg);
 }
 
-void ETSCompiler::Compile([[maybe_unused]] const ir::ClassDeclaration *st) const
-{
-    UNREACHABLE();
-}
+void ETSCompiler::Compile([[maybe_unused]] const ir::ClassDeclaration *st) const {}
 
 static void CompileImpl(const ir::ContinueStatement *self, ETSGen *etsg)
 {
@@ -2175,10 +2173,7 @@ void ETSCompiler::Compile([[maybe_unused]] const ir::TSInterfaceBody *expr) cons
     UNREACHABLE();
 }
 
-void ETSCompiler::Compile([[maybe_unused]] const ir::TSInterfaceDeclaration *st) const
-{
-    UNREACHABLE();
-}
+void ETSCompiler::Compile([[maybe_unused]] const ir::TSInterfaceDeclaration *st) const {}
 
 void ETSCompiler::Compile([[maybe_unused]] const ir::TSInterfaceHeritage *expr) const
 {
diff --git a/ets2panda/compiler/core/ETSGen.cpp b/ets2panda/compiler/core/ETSGen.cpp
index 1d6a51b9ab..49a17fb370 100644
--- a/ets2panda/compiler/core/ETSGen.cpp
+++ b/ets2panda/compiler/core/ETSGen.cpp
@@ -320,7 +320,7 @@ void ETSGen::LoadVar(const ir::AstNode *node, varbinder::Variable const *const v
         }
         case ReferenceKind::LOCAL: {
             LoadAccumulator(node, local->Vreg());
-            SetAccumulatorType(var->TsType());
+            SetAccumulatorType(TypeForVar(var));
             break;
         }
         default: {
@@ -345,7 +345,11 @@ void ETSGen::StoreVar(const ir::AstNode *node, const varbinder::ConstScopeFindRe
             break;
         }
         case ReferenceKind::FIELD: {
-            StoreProperty(node, result.variable->TsType(), GetThisReg(), result.name);
+            if (local->HasFlag(varbinder::VariableFlags::BOXED)) {
+                EmitPropertyBoxSet(node, result.variable->TsType(), GetThisReg(), result.name);
+            } else {
+                StoreProperty(node, result.variable->TsType(), GetThisReg(), result.name);
+            }
             break;
         }
         case ReferenceKind::LOCAL: {
@@ -371,7 +375,9 @@ util::StringView ETSGen::FormClassPropReference(const checker::ETSObjectType *cl
     std::string fullName = classType->AssemblerName().Mutf8();
     while (iter->EnclosingType() != nullptr) {
         auto enclosingName = iter->EnclosingType()->Name().Mutf8().append(".").append(fullName);
-        fullName = enclosingName;
+        if (iter->EnclosingType()->GetDeclNode()->Type() == ir::AstNodeType::IDENTIFIER) {
+            fullName = enclosingName;
+        }
         iter = iter->EnclosingType();
     }
 
@@ -1395,6 +1401,54 @@ void ETSGen::EmitLocalBoxSet(ir::AstNode const *node, varbinder::LocalVariable *
     SetAccumulatorType(Checker()->GetGlobalTypesHolder()->GlobalVoidType());
 }
 
+void ETSGen::EmitPropertyBoxSet(const ir::AstNode *const node, const checker::Type *propType, const VReg objectReg,
+                                const util::StringView &name)
+{
+    const auto fullName = FormClassPropReference(GetVRegType(objectReg)->AsETSObjectType(), name);
+    const RegScope rs(this);
+
+    auto inputValue = AllocReg();
+    StoreAccumulator(node, inputValue);
+
+    Ra().Emit<LdobjObj>(node, objectReg, fullName);
+    SetAccumulatorType(Checker()->GetGlobalTypesHolder()->GlobalETSObjectType());
+
+    auto field = AllocReg();
+    StoreAccumulator(node, field);
+    LoadAccumulator(node, inputValue);
+
+    switch (checker::ETSChecker::TypeKind(propType)) {
+        case checker::TypeFlag::ETS_BOOLEAN:
+            Ra().Emit<CallAccShort, 1>(node, Signatures::BUILTIN_BOOLEAN_BOX_SET, field, 1);
+            break;
+        case checker::TypeFlag::BYTE:
+            Ra().Emit<CallAccShort, 1>(node, Signatures::BUILTIN_BYTE_BOX_SET, field, 1);
+            break;
+        case checker::TypeFlag::CHAR:
+            Ra().Emit<CallAccShort, 1>(node, Signatures::BUILTIN_CHAR_BOX_SET, field, 1);
+            break;
+        case checker::TypeFlag::SHORT:
+            Ra().Emit<CallAccShort, 1>(node, Signatures::BUILTIN_SHORT_BOX_SET, field, 1);
+            break;
+        case checker::TypeFlag::INT:
+            Ra().Emit<CallAccShort, 1>(node, Signatures::BUILTIN_INT_BOX_SET, field, 1);
+            break;
+        case checker::TypeFlag::LONG:
+            Ra().Emit<CallAccShort, 1>(node, Signatures::BUILTIN_LONG_BOX_SET, field, 1);
+            break;
+        case checker::TypeFlag::FLOAT:
+            Ra().Emit<CallAccShort, 1>(node, Signatures::BUILTIN_FLOAT_BOX_SET, field, 1);
+            break;
+        case checker::TypeFlag::DOUBLE:
+            Ra().Emit<CallAccShort, 1>(node, Signatures::BUILTIN_DOUBLE_BOX_SET, field, 1);
+            break;
+        default:
+            Ra().Emit<CallAccShort, 1>(node, Signatures::BUILTIN_BOX_SET, field, 1);
+            break;
+    }
+    SetAccumulatorType(Checker()->GetGlobalTypesHolder()->GlobalVoidType());
+}
+
 void ETSGen::CastToBoolean([[maybe_unused]] const ir::AstNode *node)
 {
     auto typeKind = checker::ETSChecker::TypeKind(GetAccumulatorType());
@@ -1765,6 +1819,7 @@ void ETSGen::CastDynamicToObject(const ir::AstNode *node, const checker::Type *t
 
     // NOTE(vpukhov): #14626 remove, replace targetType with interface
     if (targetType->IsLambdaObject()) {
+        RegScope rs(this);
         VReg dynObjReg = AllocReg();
         StoreAccumulator(node, dynObjReg);
         Ra().Emit<InitobjShort>(node, targetType->AsETSObjectType()->ConstructSignatures()[0]->InternalName(),
diff --git a/ets2panda/compiler/core/ETSGen.h b/ets2panda/compiler/core/ETSGen.h
index 1daa3360f7..0ea1091c3e 100644
--- a/ets2panda/compiler/core/ETSGen.h
+++ b/ets2panda/compiler/core/ETSGen.h
@@ -377,6 +377,8 @@ public:
     void EmitLocalBoxCtor(ir::AstNode const *node);
     void EmitLocalBoxGet(ir::AstNode const *node, checker::Type const *contentType);
     void EmitLocalBoxSet(ir::AstNode const *node, varbinder::LocalVariable *lhsVar);
+    void EmitPropertyBoxSet(const ir::AstNode *node, const checker::Type *propType, VReg objectReg,
+                            const util::StringView &name);
 
     void LoadArrayLength(const ir::AstNode *node, VReg arrayReg);
     void LoadArrayElement(const ir::AstNode *node, VReg objectReg);
@@ -704,6 +706,7 @@ private:
     void BinaryDynamicStrictEquality(const ir::AstNode *node, VReg lhs, Label *ifFalse)
     {
         ASSERT(GetAccumulatorType()->IsETSDynamicType() && GetVRegType(lhs)->IsETSDynamicType());
+        RegScope scope(this);
         Ra().Emit<CallShort, 2U>(node, Signatures::BUILTIN_JSRUNTIME_STRICT_EQUAL, lhs, MoveAccToReg(node));
         Ra().Emit<DynCompare>(node, ifFalse);
     }
@@ -990,18 +993,18 @@ private:
 
         switch (arguments.size()) {
             case 0U: {
-                Ra().Emit<Short, 0>(node, signature->InternalName(), dummyReg_, dummyReg_);
+                Ra().Emit<Short, 0U>(node, signature->InternalName(), dummyReg_, dummyReg_);
                 break;
             }
             case 1U: {
                 COMPILE_ARG(0);
-                Ra().Emit<Short, 1>(node, signature->InternalName(), arg0, dummyReg_);
+                Ra().Emit<Short, 1U>(node, signature->InternalName(), arg0, dummyReg_);
                 break;
             }
             case 2U: {
                 COMPILE_ARG(0);
                 COMPILE_ARG(1);
-                Ra().Emit<Short>(node, signature->InternalName(), arg0, arg1);
+                Ra().Emit<Short, 2U>(node, signature->InternalName(), arg0, arg1);
                 break;
             }
             case 3U: {
@@ -1016,7 +1019,7 @@ private:
                 COMPILE_ARG(1);
                 COMPILE_ARG(2);
                 COMPILE_ARG(3);
-                Ra().Emit<General>(node, signature->InternalName(), arg0, arg1, arg2, arg3);
+                Ra().Emit<General, 4U>(node, signature->InternalName(), arg0, arg1, arg2, arg3);
                 break;
             }
             default: {
diff --git a/ets2panda/compiler/lowering/ets/localClassLowering.cpp b/ets2panda/compiler/lowering/ets/localClassLowering.cpp
new file mode 100644
index 0000000000..0ddf07117c
--- /dev/null
+++ b/ets2panda/compiler/lowering/ets/localClassLowering.cpp
@@ -0,0 +1,279 @@
+/*
+ * Copyright (c) 2023-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "localClassLowering.h"
+#include "checker/ETSchecker.h"
+#include "varbinder/ETSBinder.h"
+#include "../util.h"
+
+namespace ark::es2panda::compiler {
+
+std::string_view LocalClassConstructionPhase::Name() const
+{
+    return "LocalClassConstructionPhase";
+}
+
+void LocalClassConstructionPhase::ReplaceReferencesFromTheParametersToTheLocalVariavbles(
+    ir::ClassDefinition *classDef, const ArenaMap<varbinder::Variable *, varbinder::Variable *> &newLocalVariablesMap,
+    const ArenaSet<ir::Identifier *> &initializers)
+{
+    // Replace the parameter variables with the newly created temporal variables and change all the references to
+    // the new temporal variable
+    for (auto boxedVarParamsIt = newLocalVariablesMap.begin(); boxedVarParamsIt != newLocalVariablesMap.end();
+         ++boxedVarParamsIt) {
+        auto paramVar = boxedVarParamsIt->first;
+        auto newVar = boxedVarParamsIt->second;
+
+        classDef->EraseCapturedVariable(paramVar);
+        classDef->CaptureVariable(newVar);
+
+        auto *scope = paramVar->GetScope();
+        scope = scope->AsFunctionParamScope()->GetFunctionScope();
+
+        auto *block = scope->AsFunctionScope()->Node()->AsScriptFunction()->Body()->AsBlockStatement();
+
+        block->IterateRecursively([&newLocalVariablesMap, &initializers](ir::AstNode *childNode) {
+            if (childNode->Type() != ir::AstNodeType::IDENTIFIER ||
+                initializers.find(childNode->AsIdentifier()) != initializers.end()) {
+                return;
+            }
+            const auto &newMapIt = newLocalVariablesMap.find(childNode->AsIdentifier()->Variable());
+            if (newMapIt != newLocalVariablesMap.end()) {
+                LOG(DEBUG, ES2PANDA) << "      Remap param variable: " << childNode->AsIdentifier()->Name()
+                                     << " (identifier:" << (void *)childNode
+                                     << ") variable:" << (void *)childNode->AsIdentifier()->Variable()
+                                     << " -> temporal variable:" << (void *)newMapIt->second;
+                childNode->AsIdentifier()->SetVariable(newMapIt->second);
+            }
+        });
+    }
+}
+
+void LocalClassConstructionPhase::CreateTemporalLocalVariableForModifiedParameters(public_lib::Context *ctx,
+                                                                                   ir::ClassDefinition *classDef)
+{
+    // Store the new variables created for the function parameters needed to be boxed
+    ArenaMap<varbinder::Variable *, varbinder::Variable *> newLocalVariablesMap(ctx->allocator->Adapter());
+
+    // Store the new variables created for the function parameters needed to be boxed
+    ArenaSet<ir::Identifier *> initializers(ctx->allocator->Adapter());
+
+    // Create local variables for modified parameters since the parameters can not be boxed
+    for (auto var : classDef->CapturedVariables()) {
+        if (var->Declaration() != nullptr && var->Declaration()->IsParameterDecl() &&
+            classDef->IsLocalVariableNeeded(var)) {
+            auto *scope = var->GetScope();
+            ASSERT(scope->IsFunctionParamScope());
+            scope = scope->AsFunctionParamScope()->GetFunctionScope();
+            ASSERT(scope->AsFunctionScope()->Node()->IsScriptFunction());
+            ASSERT(scope->AsFunctionScope()->Node()->AsScriptFunction()->Body()->IsBlockStatement());
+            auto *param = var->Declaration()->AsParameterDecl();
+            auto *block = scope->AsFunctionScope()->Node()->AsScriptFunction()->Body()->AsBlockStatement();
+
+            auto *newVarIdentifier = Gensym(ctx->allocator);
+
+            auto *newVar = scope->AddDecl<varbinder::LetDecl, varbinder::LocalVariable>(
+                ctx->allocator, newVarIdentifier->Name(), varbinder::VariableFlags::LOCAL);
+
+            newVarIdentifier->SetVariable(newVar);
+            newVar->SetTsType(var->TsType());
+            newVar->AddFlag(varbinder::VariableFlags::BOXED);
+
+            auto *initializer = ctx->allocator->New<ir::Identifier>(param->Name(), ctx->allocator);
+            initializer->SetVariable(var);
+            initializer->SetTsType(var->TsType());
+
+            initializers.insert(initializer);
+            auto *declarator = ctx->allocator->New<ir::VariableDeclarator>(ir::VariableDeclaratorFlag::LET,
+                                                                           newVarIdentifier, initializer);
+
+            newVarIdentifier->SetParent(declarator);
+            initializer->SetParent(declarator);
+
+            ArenaVector<ir::VariableDeclarator *> declarators(ctx->allocator->Adapter());
+            declarators.push_back(declarator);
+
+            auto *newVariableDeclaration = ctx->allocator->New<ir::VariableDeclaration>(
+                ir::VariableDeclaration::VariableDeclarationKind::LET, ctx->allocator, std::move(declarators), false);
+
+            declarator->SetParent(newVariableDeclaration);
+            newVariableDeclaration->SetParent(block);
+            block->Statements().insert(block->Statements().begin(), newVariableDeclaration);
+
+            newLocalVariablesMap[var] = newVar;
+        }
+    }
+
+    ReplaceReferencesFromTheParametersToTheLocalVariavbles(classDef, newLocalVariablesMap, initializers);
+}
+
+void LocalClassConstructionPhase::CreateClassPropertiesForCapturedVariables(
+    public_lib::Context *ctx, ir::ClassDefinition *classDef,
+    ArenaMap<varbinder::Variable *, varbinder::Variable *> &variableMap,
+    ArenaMap<varbinder::Variable *, ir::ClassProperty *> &propertyMap)
+{
+    checker::ETSChecker *const checker = ctx->checker->AsETSChecker();
+    size_t idx = 0;
+    ArenaVector<ir::AstNode *> properties(ctx->allocator->Adapter());
+    for (auto var : classDef->CapturedVariables()) {
+        ASSERT(classDef->Scope()->Type() == varbinder::ScopeType::CLASS);
+        auto *property = checker->CreateLambdaCapturedField(
+            var, reinterpret_cast<varbinder::ClassScope *>(classDef->Scope()), idx, classDef->Start());
+        LOG(DEBUG, ES2PANDA) << "  - Creating property (" << property->Id()->Name()
+                             << ") for captured variable: " << var->Name();
+        properties.push_back(property);
+        variableMap[var] = property->Id()->Variable();
+        propertyMap[var] = property;
+        idx++;
+    }
+
+    classDef->AddProperties(std::move(properties));
+}
+
+void LocalClassConstructionPhase::ModifyConstructorParameters(
+    public_lib::Context *ctx, ir::ClassDefinition *classDef,
+    ArenaMap<varbinder::Variable *, varbinder::Variable *> &variableMap,
+    ArenaMap<varbinder::Variable *, varbinder::Variable *> &parameterMap)
+
+{
+    auto *classType = classDef->TsType()->AsETSObjectType();
+    checker::ETSChecker *const checker = ctx->checker->AsETSChecker();
+
+    for (auto *signature : classType->ConstructSignatures()) {
+        LOG(DEBUG, ES2PANDA) << "  - Modifying Constructor: " << signature->InternalName();
+        auto constructor = signature->Function();
+        auto &parameters = constructor->Params();
+        auto &sigParams = signature->Params();
+        signature->GetSignatureInfo()->minArgCount += classDef->CapturedVariables().size();
+
+        ASSERT(signature == constructor->Signature());
+        for (auto var : classDef->CapturedVariables()) {
+            auto *newParam =
+                checker->AddParam(constructor->Scope()->ParamScope(), var->Name(), checker->MaybeBoxedType(var));
+            newParam->SetParent(constructor);
+            // NOTE(psiket) : Moving the parameter after the 'this'. Should modify the AddParam
+            // to be able to insert after the this.
+            auto &paramScopeParams = constructor->Scope()->ParamScope()->Params();
+            auto thisParamIt = ++paramScopeParams.begin();
+            paramScopeParams.insert(thisParamIt, paramScopeParams.back());
+            paramScopeParams.pop_back();
+
+            parameters.insert(parameters.begin(), newParam);
+            ASSERT(newParam->Variable()->Type() == varbinder::VariableType::LOCAL);
+            sigParams.insert(sigParams.begin(), newParam->Ident()->Variable()->AsLocalVariable());
+            parameterMap[var] = newParam->Ident()->Variable()->AsLocalVariable();
+        }
+        reinterpret_cast<varbinder::ETSBinder *>(checker->VarBinder())->BuildFunctionName(constructor);
+        LOG(DEBUG, ES2PANDA) << "    Transformed Constructor: " << signature->InternalName();
+
+        auto *body = constructor->Body();
+        ArenaVector<ir::Statement *> initStatements(ctx->allocator->Adapter());
+        for (auto var : classDef->CapturedVariables()) {
+            auto *propertyVar = variableMap[var];
+            auto *initStatement = checker->CreateLambdaCtorFieldInit(propertyVar->Name(), propertyVar);
+            auto *fieldInit = initStatement->AsExpressionStatement()->GetExpression()->AsAssignmentExpression();
+            auto *ctorParamVar = parameterMap[var];
+            auto *fieldVar = variableMap[var];
+            auto *leftHandSide = fieldInit->Left();
+            leftHandSide->AsMemberExpression()->SetObjectType(classType);
+            leftHandSide->AsMemberExpression()->SetPropVar(fieldVar->AsLocalVariable());
+            leftHandSide->AsMemberExpression()->SetIgnoreBox();
+            leftHandSide->AsMemberExpression()->SetTsType(fieldVar->TsType());
+            leftHandSide->AsMemberExpression()->Object()->SetTsType(classType);
+            fieldInit->Right()->AsIdentifier()->SetVariable(ctorParamVar);
+            fieldInit->Right()->SetTsType(ctorParamVar->TsType());
+            initStatement->SetParent(body);
+            initStatements.push_back(initStatement);
+        }
+        auto &statements = body->AsBlockStatement()->Statements();
+        statements.insert(statements.begin(), initStatements.begin(), initStatements.end());
+    }
+}
+
+void LocalClassConstructionPhase::RemapReferencesFromCapturedVariablesToClassProperties(
+    ir::ClassDefinition *classDef, ArenaMap<varbinder::Variable *, varbinder::Variable *> &variableMap)
+{
+    auto *classType = classDef->TsType()->AsETSObjectType();
+    auto remapCapturedVariables = [&variableMap](ir::AstNode *childNode) {
+        if (childNode->Type() == ir::AstNodeType::IDENTIFIER) {
+            LOG(DEBUG, ES2PANDA) << "    checking var:" << (void *)childNode;
+            const auto &mapIt = variableMap.find(childNode->AsIdentifier()->Variable());
+            if (mapIt != variableMap.end()) {
+                LOG(DEBUG, ES2PANDA) << "      Remap: " << childNode->AsIdentifier()->Name()
+                                     << " (identifier:" << (void *)childNode
+                                     << ") variable:" << (void *)childNode->AsIdentifier()->Variable()
+                                     << " -> property variable:" << (void *)mapIt->second;
+                childNode->AsIdentifier()->SetVariable(mapIt->second);
+            } else {
+            }
+        }
+    };
+
+    for (auto *it : classDef->Body()) {
+        if (it->IsMethodDefinition() && !it->AsMethodDefinition()->IsConstructor()) {
+            LOG(DEBUG, ES2PANDA) << "  - Rebinding variable rerferences in: "
+                                 << it->AsMethodDefinition()->Id()->Name().Mutf8().c_str();
+            it->AsMethodDefinition()->Function()->Body()->IterateRecursively(remapCapturedVariables);
+        }
+    }
+    // Since the constructor with zero parameter is not listed in the class_def body the constructors
+    // processed separately
+    for (auto *signature : classType->ConstructSignatures()) {
+        auto *constructor = signature->Function();
+        LOG(DEBUG, ES2PANDA) << "  - Rebinding variable rerferences in: " << constructor->Id()->Name();
+        constructor->Body()->IterateRecursively(remapCapturedVariables);
+    }
+}
+
+bool LocalClassConstructionPhase::Perform(public_lib::Context *ctx, parser::Program * /*program*/)
+{
+    checker::ETSChecker *const checker = ctx->checker->AsETSChecker();
+    for (auto *classDef : checker->GetLocalClasses()) {
+        LOG(DEBUG, ES2PANDA) << "Altering local class with the captured variables: " << classDef->InternalName();
+        // Map the captured variable to the variable of the class property
+        ArenaMap<varbinder::Variable *, varbinder::Variable *> variableMap(ctx->allocator->Adapter());
+        // Map the captured variable to the class property
+        ArenaMap<varbinder::Variable *, ir::ClassProperty *> propertyMap(ctx->allocator->Adapter());
+        // Map the captured variable to the constructor parameter
+        ArenaMap<varbinder::Variable *, varbinder::Variable *> parameterMap(ctx->allocator->Adapter());
+
+        CreateTemporalLocalVariableForModifiedParameters(ctx, classDef);
+        CreateClassPropertiesForCapturedVariables(ctx, classDef, variableMap, propertyMap);
+        ModifyConstructorParameters(ctx, classDef, variableMap, parameterMap);
+        RemapReferencesFromCapturedVariablesToClassProperties(classDef, variableMap);
+    }
+
+    // Alter the instantiations
+    for (auto *newExpr : checker->GetLocalClassInstantiations()) {
+        checker::Type *calleeType = newExpr->GetTypeRef()->Check(checker);
+        auto *calleeObj = calleeType->AsETSObjectType();
+        auto *classDef = calleeObj->GetDeclNode()->AsClassDefinition();
+        LOG(DEBUG, ES2PANDA) << "Instantiating local class: " << classDef->Ident()->Name();
+        for (auto *var : classDef->CapturedVariables()) {
+            LOG(DEBUG, ES2PANDA) << "  - Extending constructor argument with captured variable: " << var->Name();
+
+            auto *param = checker->AllocNode<ir::Identifier>(var->Name(), ctx->allocator);
+            param->SetVariable(var);
+            param->SetIgnoreBox();
+            param->SetTsType(checker->AsETSChecker()->MaybeBoxedType(param->Variable()));
+            param->SetParent(newExpr);
+            newExpr->AddToArgumentsFront(param);
+        }
+    }
+
+    return true;
+}
+
+}  // namespace ark::es2panda::compiler
diff --git a/ets2panda/compiler/lowering/ets/localClassLowering.h b/ets2panda/compiler/lowering/ets/localClassLowering.h
new file mode 100644
index 0000000000..297ca7c0ed
--- /dev/null
+++ b/ets2panda/compiler/lowering/ets/localClassLowering.h
@@ -0,0 +1,50 @@
+/*
+ * Copyright (c) 2023-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ES2PANDA_COMPILER_LOWERING_LOCAL_CLASS_LOWERING_H
+#define ES2PANDA_COMPILER_LOWERING_LOCAL_CLASS_LOWERING_H
+
+#include "compiler/lowering/phase.h"
+
+namespace ark::es2panda::compiler {
+
+class LocalClassConstructionPhase : public Phase {
+public:
+    std::string_view Name() const override;
+    bool Perform(public_lib::Context *ctx, parser::Program *program) override;
+
+protected:
+    void ReplaceReferencesFromTheParametersToTheLocalVariavbles(
+        ir::ClassDefinition *classDef,
+        const ArenaMap<varbinder::Variable *, varbinder::Variable *> &newLocalVariablesMap,
+        const ArenaSet<ir::Identifier *> &initializers);
+
+    void CreateTemporalLocalVariableForModifiedParameters(public_lib::Context *ctx, ir::ClassDefinition *classDef);
+
+    void CreateClassPropertiesForCapturedVariables(public_lib::Context *ctx, ir::ClassDefinition *classDef,
+                                                   ArenaMap<varbinder::Variable *, varbinder::Variable *> &variableMap,
+                                                   ArenaMap<varbinder::Variable *, ir::ClassProperty *> &propertyMap);
+
+    void ModifyConstructorParameters(public_lib::Context *ctx, ir::ClassDefinition *classDef,
+                                     ArenaMap<varbinder::Variable *, varbinder::Variable *> &variableMap,
+                                     ArenaMap<varbinder::Variable *, varbinder::Variable *> &parameterMap);
+
+    void RemapReferencesFromCapturedVariablesToClassProperties(
+        ir::ClassDefinition *classDef, ArenaMap<varbinder::Variable *, varbinder::Variable *> &variableMap);
+};
+
+}  // namespace ark::es2panda::compiler
+
+#endif
diff --git a/ets2panda/compiler/lowering/phase.cpp b/ets2panda/compiler/lowering/phase.cpp
index e42c608c4d..475224675f 100644
--- a/ets2panda/compiler/lowering/phase.cpp
+++ b/ets2panda/compiler/lowering/phase.cpp
@@ -25,6 +25,7 @@
 #include "compiler/lowering/ets/interfacePropertyDeclarations.h"
 #include "compiler/lowering/ets/objectIndexAccess.h"
 #include "compiler/lowering/ets/objectIterator.h"
+#include "compiler/lowering/ets/localClassLowering.h"
 #include "compiler/lowering/ets/opAssignment.h"
 #include "compiler/lowering/ets/optionalLowering.h"
 #include "compiler/lowering/ets/promiseVoid.h"
@@ -65,6 +66,7 @@ static PromiseVoidInferencePhase g_promiseVoidInferencePhase;
 static RecordLowering g_recordLowering;
 static StructLowering g_structLowering;
 static DefaultParameterLowering g_defaultParameterLowering;
+static LocalClassConstructionPhase g_localClassLowering;
 static PluginPhase g_pluginsAfterParse {"plugins-after-parse", ES2PANDA_STATE_PARSED, &util::Plugin::AfterParse};
 static PluginPhase g_pluginsAfterCheck {"plugins-after-check", ES2PANDA_STATE_CHECKED, &util::Plugin::AfterCheck};
 static PluginPhase g_pluginsAfterLowerings {"plugins-after-lowering", ES2PANDA_STATE_LOWERED,
@@ -98,6 +100,7 @@ std::vector<Phase *> GetETSPhaseList()
         &g_tupleLowering,
         &g_unionLowering,
         &g_expandBracketsPhase,
+        &g_localClassLowering,
         &g_pluginsAfterLowerings,
     };
 }
diff --git a/ets2panda/ir/base/classDefinition.cpp b/ets2panda/ir/base/classDefinition.cpp
index 63a0e697e2..ff13e4cb42 100644
--- a/ets2panda/ir/base/classDefinition.cpp
+++ b/ets2panda/ir/base/classDefinition.cpp
@@ -214,4 +214,7 @@ checker::Type *ClassDefinition::Check(checker::ETSChecker *checker)
 {
     return checker->GetAnalyzer()->Check(this);
 }
+
+int ClassDefinition::classCounter_ = 0;
+
 }  // namespace ark::es2panda::ir
diff --git a/ets2panda/ir/base/classDefinition.h b/ets2panda/ir/base/classDefinition.h
index c449678822..14e88c6602 100644
--- a/ets2panda/ir/base/classDefinition.h
+++ b/ets2panda/ir/base/classDefinition.h
@@ -19,6 +19,7 @@
 #include "varbinder/scope.h"
 #include "varbinder/variable.h"
 #include "ir/astNode.h"
+#include "ir/expressions/identifier.h"
 #include "util/bitset.h"
 #include "util/language.h"
 
@@ -44,6 +45,7 @@ enum class ClassDefinitionModifiers : uint32_t {
     CLASS_DECL = 1U << 8U,
     INNER = 1U << 9U,
     FROM_EXTERNAL = 1U << 10U,
+    LOCAL = 1U << 11U,
     DECLARATION_ID_REQUIRED = DECLARATION | ID_REQUIRED
 };
 
@@ -72,7 +74,11 @@ public:
           superClass_(superClass),
           body_(std::move(body)),
           modifiers_(modifiers),
-          lang_(lang)
+          lang_(lang),
+          capturedVars_(body_.get_allocator()),
+          localVariableIsNeeded_(body_.get_allocator()),
+          localIndex_(classCounter_++),
+          localPrefix_("$" + std::to_string(localIndex_))
     {
     }
 
@@ -83,7 +89,11 @@ public:
           implements_(allocator->Adapter()),
           body_(std::move(body)),
           modifiers_(modifiers),
-          lang_(lang)
+          lang_(lang),
+          capturedVars_(allocator->Adapter()),
+          localVariableIsNeeded_(allocator->Adapter()),
+          localIndex_(classCounter_++),
+          localPrefix_("$" + std::to_string(localIndex_))
     {
     }
 
@@ -94,7 +104,12 @@ public:
           implements_(allocator->Adapter()),
           body_(allocator->Adapter()),
           modifiers_(modifiers),
-          lang_(lang)
+          lang_(lang),
+          capturedVars_(allocator->Adapter()),
+          localVariableIsNeeded_(allocator->Adapter()),
+          localIndex_(classCounter_++),
+          localPrefix_("$" + std::to_string(localIndex_))
+
     {
     }
 
@@ -163,6 +178,11 @@ public:
         return (modifiers_ & ClassDefinitionModifiers::GLOBAL) != 0;
     }
 
+    [[nodiscard]] bool IsLocal() const noexcept
+    {
+        return (modifiers_ & ClassDefinitionModifiers::LOCAL) != 0;
+    }
+
     [[nodiscard]] bool IsExtern() const noexcept
     {
         return (modifiers_ & ClassDefinitionModifiers::EXTERN) != 0;
@@ -266,6 +286,46 @@ public:
         return superTypeParams_;
     }
 
+    [[nodiscard]] static int LocalTypeCounter() noexcept
+    {
+        return classCounter_;
+    }
+
+    [[nodiscard]] int LocalIndex() const noexcept
+    {
+        return localIndex_;
+    }
+
+    [[nodiscard]] const std::string &LocalPrefix() const noexcept
+    {
+        return localPrefix_;
+    }
+
+    bool CaptureVariable(varbinder::Variable *var)
+    {
+        return capturedVars_.insert(var).second;
+    }
+
+    bool AddToLocalVariableIsNeeded(varbinder::Variable *var)
+    {
+        return localVariableIsNeeded_.insert(var).second;
+    }
+
+    bool IsLocalVariableNeeded(varbinder::Variable *var) const
+    {
+        return localVariableIsNeeded_.find(var) != localVariableIsNeeded_.end();
+    }
+
+    [[nodiscard]] const ArenaSet<varbinder::Variable *> &CapturedVariables() const noexcept
+    {
+        return capturedVars_;
+    }
+
+    bool EraseCapturedVariable(varbinder::Variable *var)
+    {
+        return capturedVars_.erase(var) != 0;
+    }
+
     const FunctionExpression *Ctor() const;
     bool HasPrivateMethod() const;
     bool HasComputedInstanceField() const;
@@ -301,6 +361,11 @@ private:
     ArenaVector<AstNode *> body_;
     ClassDefinitionModifiers modifiers_;
     es2panda::Language lang_;
+    ArenaSet<varbinder::Variable *> capturedVars_;
+    ArenaSet<varbinder::Variable *> localVariableIsNeeded_;
+    static int classCounter_;
+    const int localIndex_ {};
+    const std::string localPrefix_ {};
 };
 }  // namespace ark::es2panda::ir
 
diff --git a/ets2panda/ir/ets/etsNewClassInstanceExpression.h b/ets2panda/ir/ets/etsNewClassInstanceExpression.h
index 2ce17a38e3..8a61de6288 100644
--- a/ets2panda/ir/ets/etsNewClassInstanceExpression.h
+++ b/ets2panda/ir/ets/etsNewClassInstanceExpression.h
@@ -85,6 +85,11 @@ public:
         signature_ = signature;
     }
 
+    void AddToArgumentsFront(ir::Expression *expr)
+    {
+        arguments_.insert(arguments_.begin(), expr);
+    }
+
     [[nodiscard]] ETSNewClassInstanceExpression *Clone(ArenaAllocator *allocator, AstNode *parent) override;
 
     void TransformChildren(const NodeTransformer &cb) override;
diff --git a/ets2panda/parser/ETSparser.cpp b/ets2panda/parser/ETSparser.cpp
index b9dda5ffca..9acf87f03a 100644
--- a/ets2panda/parser/ETSparser.cpp
+++ b/ets2panda/parser/ETSparser.cpp
@@ -863,6 +863,12 @@ std::tuple<ir::ModifierFlags, bool> ETSParser::ParseClassMemberAccessModifiers()
                 UNREACHABLE();
             }
         }
+        if (((GetContext().Status() & ParserStatus::FUNCTION) != 0) &&
+            (accessFlag == ir::ModifierFlags::PUBLIC || accessFlag == ir::ModifierFlags::PRIVATE ||
+             accessFlag == ir::ModifierFlags::PROTECTED)) {
+            ThrowSyntaxError("Local class declaration members can not have access modifies",
+                             Lexer()->GetToken().Start());
+        }
 
         Lexer()->NextToken(lexer::NextTokenFlags::KEYWORD_TO_IDENT);
         return {accessFlag, true};
@@ -1663,10 +1669,6 @@ ir::TSInterfaceDeclaration *ETSParser::ParseInterfaceBody(ir::Identifier *name,
 
 ir::Statement *ETSParser::ParseInterfaceDeclaration(bool isStatic)
 {
-    if ((GetContext().Status() & parser::ParserStatus::FUNCTION) != 0U) {
-        ThrowSyntaxError("Local interface declaration support is not yet implemented.");
-    }
-
     lexer::SourcePosition interfaceStart = Lexer()->GetToken().Start();
     Lexer()->NextToken();  // eat interface keyword
 
@@ -1765,7 +1767,9 @@ ir::ClassDefinition *ETSParser::ParseClassDefinition(ir::ClassDefinitionModifier
 
 static bool IsInterfaceMethodModifier(lexer::TokenType type)
 {
-    return type == lexer::TokenType::KEYW_STATIC || type == lexer::TokenType::KEYW_PRIVATE;
+    // NOTE (psiket) Rewrite this
+    return type == lexer::TokenType::KEYW_STATIC || type == lexer::TokenType::KEYW_PRIVATE ||
+           type == lexer::TokenType::KEYW_PROTECTED || type == lexer::TokenType::KEYW_PUBLIC;
 }
 
 ir::ModifierFlags ETSParser::ParseInterfaceMethodModifiers()
@@ -1775,6 +1779,17 @@ ir::ModifierFlags ETSParser::ParseInterfaceMethodModifiers()
     while (IsInterfaceMethodModifier(Lexer()->GetToken().Type())) {
         ir::ModifierFlags currentFlag = ir::ModifierFlags::NONE;
 
+        if ((GetContext().Status() & ParserStatus::FUNCTION) != 0) {
+            if (Lexer()->GetToken().Type() == lexer::TokenType::KEYW_PUBLIC ||
+                Lexer()->GetToken().Type() == lexer::TokenType::KEYW_PROTECTED ||
+                Lexer()->GetToken().Type() == lexer::TokenType::KEYW_PRIVATE) {
+                ThrowSyntaxError("Local interface declaration members can not have access modifies",
+                                 Lexer()->GetToken().Start());
+            }
+        } else if (Lexer()->GetToken().Type() == lexer::TokenType::KEYW_PUBLIC ||
+                   Lexer()->GetToken().Type() == lexer::TokenType::KEYW_PROTECTED) {
+            break;
+        }
         switch (Lexer()->GetToken().Type()) {
             case lexer::TokenType::KEYW_STATIC: {
                 currentFlag = ir::ModifierFlags::STATIC;
@@ -4145,7 +4160,9 @@ ir::ClassDeclaration *ETSParser::ParseClassStatement([[maybe_unused]] StatementP
                                                      [[maybe_unused]] ir::ClassDefinitionModifiers modifiers,
                                                      [[maybe_unused]] ir::ModifierFlags modFlags)
 {
-    ThrowSyntaxError("Illegal start of expression", Lexer()->GetToken().Start());
+    return ParseClassDeclaration(modifiers | ir::ClassDefinitionModifiers::ID_REQUIRED |
+                                     ir::ClassDefinitionModifiers::CLASS_DECL | ir::ClassDefinitionModifiers::LOCAL,
+                                 modFlags);
 }
 
 // NOLINTNEXTLINE(google-default-arguments)
diff --git a/ets2panda/parser/statementParser.cpp b/ets2panda/parser/statementParser.cpp
index 99e669f255..5c94e99926 100644
--- a/ets2panda/parser/statementParser.cpp
+++ b/ets2panda/parser/statementParser.cpp
@@ -619,6 +619,18 @@ ir::Statement *ParserImpl::ParseExpressionStatement(StatementParsingFlags flags)
     const auto startPos = lexer_->Save();
     ParserStatus savedStatus = context_.Status();
 
+    auto tokenType = lexer_->GetToken().Type();
+    if (tokenType == lexer::TokenType::KEYW_PUBLIC || tokenType == lexer::TokenType::KEYW_PRIVATE ||
+        tokenType == lexer::TokenType::KEYW_PROTECTED) {
+        lexer_->NextToken();
+        if (lexer_->GetToken().Type() == lexer::TokenType::KEYW_CLASS ||
+            lexer_->GetToken().Type() == lexer::TokenType::KEYW_INTERFACE) {
+            ThrowSyntaxError("A local class or interface declaration can not have access modifier",
+                             startPos.GetToken().Start());
+        }
+        lexer_->Rewind(startPos);
+    }
+
     if (lexer_->GetToken().IsAsyncModifier()) {
         lexer_->NextToken();
 
diff --git a/ets2panda/test/compiler/ets/identifierReference1-expected.txt b/ets2panda/test/compiler/ets/identifierReference1-expected.txt
index 5a98acf91b..df7fd437f9 100644
--- a/ets2panda/test/compiler/ets/identifierReference1-expected.txt
+++ b/ets2panda/test/compiler/ets/identifierReference1-expected.txt
@@ -1,1966 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "B",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 9,
-              "column": 12
-            },
-            "end": {
-              "line": 9,
-              "column": 13
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "b",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 10,
-                  "column": 3
-                },
-                "end": {
-                  "line": 10,
-                  "column": 4
-                }
-              }
-            },
-            "value": {
-              "type": "NumberLiteral",
-              "value": 2,
-              "loc": {
-                "start": {
-                  "line": 10,
-                  "column": 12
-                },
-                "end": {
-                  "line": 10,
-                  "column": 13
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": false,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSPrimitiveType",
-              "loc": {
-                "start": {
-                  "line": 10,
-                  "column": 6
-                },
-                "end": {
-                  "line": 10,
-                  "column": 9
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "c",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 11,
-                  "column": 10
-                },
-                "end": {
-                  "line": 11,
-                  "column": 11
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": true,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSFunctionType",
-              "params": [
-                {
-                  "type": "Identifier",
-                  "name": "a",
-                  "typeAnnotation": {
-                    "type": "ETSPrimitiveType",
-                    "loc": {
-                      "start": {
-                        "line": 11,
-                        "column": 17
-                      },
-                      "end": {
-                        "line": 11,
-                        "column": 20
-                      }
-                    }
-                  },
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 11,
-                      "column": 14
-                    },
-                    "end": {
-                      "line": 11,
-                      "column": 20
-                    }
-                  }
-                }
-              ],
-              "returnType": {
-                "type": "ETSPrimitiveType",
-                "loc": {
-                  "start": {
-                    "line": 11,
-                    "column": 25
-                  },
-                  "end": {
-                    "line": 11,
-                    "column": 29
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 11,
-                  "column": 13
-                },
-                "end": {
-                  "line": 11,
-                  "column": 29
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "foo",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 12,
-                  "column": 3
-                },
-                "end": {
-                  "line": 12,
-                  "column": 6
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "foo",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 12,
-                      "column": 3
-                    },
-                    "end": {
-                      "line": 12,
-                      "column": 6
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [
-                  {
-                    "type": "Identifier",
-                    "name": "a",
-                    "typeAnnotation": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 12,
-                          "column": 10
-                        },
-                        "end": {
-                          "line": 12,
-                          "column": 13
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 12,
-                        "column": 7
-                      },
-                      "end": {
-                        "line": 12,
-                        "column": 13
-                      }
-                    }
-                  }
-                ],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 12,
-                      "column": 16
-                    },
-                    "end": {
-                      "line": 12,
-                      "column": 20
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 12,
-                      "column": 21
-                    },
-                    "end": {
-                      "line": 14,
-                      "column": 4
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 12,
-                    "column": 6
-                  },
-                  "end": {
-                    "line": 14,
-                    "column": 4
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 12,
-                  "column": 6
-                },
-                "end": {
-                  "line": 14,
-                  "column": 4
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 12,
-                "column": 3
-              },
-              "end": {
-                "line": 14,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 15,
-                "column": 2
-              },
-              "end": {
-                "line": 15,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 9,
-            "column": 14
-          },
-          "end": {
-            "line": 15,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 9,
-          "column": 6
-        },
-        "end": {
-          "line": 15,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "A",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 17,
-              "column": 7
-            },
-            "end": {
-              "line": 17,
-              "column": 8
-            }
-          }
-        },
-        "superClass": {
-          "type": "ETSTypeReference",
-          "part": {
-            "type": "ETSTypeReferencePart",
-            "name": {
-              "type": "Identifier",
-              "name": "B",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 17,
-                  "column": 17
-                },
-                "end": {
-                  "line": 17,
-                  "column": 18
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 17,
-                "column": 17
-              },
-              "end": {
-                "line": 17,
-                "column": 20
-              }
-            }
-          },
-          "loc": {
-            "start": {
-              "line": 17,
-              "column": 17
-            },
-            "end": {
-              "line": 17,
-              "column": 20
-            }
-          }
-        },
-        "implements": [],
-        "body": [
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "foo",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 18,
-                  "column": 3
-                },
-                "end": {
-                  "line": 18,
-                  "column": 6
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "foo",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 18,
-                      "column": 3
-                    },
-                    "end": {
-                      "line": 18,
-                      "column": 6
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [
-                  {
-                    "type": "Identifier",
-                    "name": "a",
-                    "typeAnnotation": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 18,
-                          "column": 10
-                        },
-                        "end": {
-                          "line": 18,
-                          "column": 13
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 18,
-                        "column": 7
-                      },
-                      "end": {
-                        "line": 18,
-                        "column": 13
-                      }
-                    }
-                  },
-                  {
-                    "type": "Identifier",
-                    "name": "b",
-                    "typeAnnotation": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 18,
-                          "column": 18
-                        },
-                        "end": {
-                          "line": 18,
-                          "column": 21
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 18,
-                        "column": 15
-                      },
-                      "end": {
-                        "line": 18,
-                        "column": 21
-                      }
-                    }
-                  }
-                ],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 18,
-                      "column": 24
-                    },
-                    "end": {
-                      "line": 18,
-                      "column": 28
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "AssignmentExpression",
-                        "operator": "=",
-                        "left": {
-                          "type": "Identifier",
-                          "name": "b",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 19,
-                              "column": 5
-                            },
-                            "end": {
-                              "line": 19,
-                              "column": 6
-                            }
-                          }
-                        },
-                        "right": {
-                          "type": "NumberLiteral",
-                          "value": 3,
-                          "loc": {
-                            "start": {
-                              "line": 19,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 19,
-                              "column": 10
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 19,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 19,
-                            "column": 10
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 19,
-                          "column": 5
-                        },
-                        "end": {
-                          "line": 19,
-                          "column": 11
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 18,
-                      "column": 29
-                    },
-                    "end": {
-                      "line": 20,
-                      "column": 4
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 18,
-                    "column": 6
-                  },
-                  "end": {
-                    "line": 20,
-                    "column": 4
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 18,
-                  "column": 6
-                },
-                "end": {
-                  "line": 20,
-                  "column": 4
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 18,
-                "column": 3
-              },
-              "end": {
-                "line": 20,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "foo",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 22,
-                  "column": 10
-                },
-                "end": {
-                  "line": 22,
-                  "column": 13
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": true,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "foo",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 22,
-                      "column": 10
-                    },
-                    "end": {
-                      "line": 22,
-                      "column": 13
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 22,
-                      "column": 17
-                    },
-                    "end": {
-                      "line": 22,
-                      "column": 21
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "AssignmentExpression",
-                        "operator": "=",
-                        "left": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "A",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 23,
-                                "column": 5
-                              },
-                              "end": {
-                                "line": 23,
-                                "column": 6
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "c",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 23,
-                                "column": 7
-                              },
-                              "end": {
-                                "line": 23,
-                                "column": 8
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 23,
-                              "column": 5
-                            },
-                            "end": {
-                              "line": 23,
-                              "column": 8
-                            }
-                          }
-                        },
-                        "right": {
-                          "type": "Identifier",
-                          "name": "bar",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 23,
-                              "column": 11
-                            },
-                            "end": {
-                              "line": 23,
-                              "column": 14
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 23,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 23,
-                            "column": 14
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 23,
-                          "column": 5
-                        },
-                        "end": {
-                          "line": 23,
-                          "column": 15
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 22,
-                      "column": 22
-                    },
-                    "end": {
-                      "line": 24,
-                      "column": 4
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 22,
-                    "column": 13
-                  },
-                  "end": {
-                    "line": 24,
-                    "column": 4
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 22,
-                  "column": 13
-                },
-                "end": {
-                  "line": 24,
-                  "column": 4
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 22,
-                "column": 3
-              },
-              "end": {
-                "line": 24,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "baz",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 26,
-                  "column": 3
-                },
-                "end": {
-                  "line": 26,
-                  "column": 6
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "baz",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 26,
-                      "column": 3
-                    },
-                    "end": {
-                      "line": 26,
-                      "column": 6
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 26,
-                      "column": 10
-                    },
-                    "end": {
-                      "line": 26,
-                      "column": 14
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "ThisExpression",
-                            "loc": {
-                              "start": {
-                                "line": 27,
-                                "column": 5
-                              },
-                              "end": {
-                                "line": 27,
-                                "column": 9
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "foo",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 27,
-                                "column": 10
-                              },
-                              "end": {
-                                "line": 27,
-                                "column": 13
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 27,
-                              "column": 5
-                            },
-                            "end": {
-                              "line": 27,
-                              "column": 13
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "NumberLiteral",
-                            "value": 1,
-                            "loc": {
-                              "start": {
-                                "line": 27,
-                                "column": 14
-                              },
-                              "end": {
-                                "line": 27,
-                                "column": 15
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 27,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 27,
-                            "column": 16
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 27,
-                          "column": 5
-                        },
-                        "end": {
-                          "line": 27,
-                          "column": 17
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 26,
-                      "column": 15
-                    },
-                    "end": {
-                      "line": 28,
-                      "column": 4
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 26,
-                    "column": 6
-                  },
-                  "end": {
-                    "line": 28,
-                    "column": 4
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 26,
-                  "column": 6
-                },
-                "end": {
-                  "line": 28,
-                  "column": 4
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 26,
-                "column": 3
-              },
-              "end": {
-                "line": 28,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "C",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 30,
-                    "column": 9
-                  },
-                  "end": {
-                    "line": 30,
-                    "column": 10
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "foo",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 31,
-                        "column": 5
-                      },
-                      "end": {
-                        "line": 31,
-                        "column": 8
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "foo",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 31,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 31,
-                            "column": 8
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 31,
-                            "column": 12
-                          },
-                          "end": {
-                            "line": 31,
-                            "column": 16
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "AssignmentExpression",
-                              "operator": "=",
-                              "left": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "ThisExpression",
-                                  "loc": {
-                                    "start": {
-                                      "line": 32,
-                                      "column": 7
-                                    },
-                                    "end": {
-                                      "line": 32,
-                                      "column": 11
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "b",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 32,
-                                      "column": 12
-                                    },
-                                    "end": {
-                                      "line": 32,
-                                      "column": 13
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 32,
-                                    "column": 7
-                                  },
-                                  "end": {
-                                    "line": 32,
-                                    "column": 13
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "NumberLiteral",
-                                "value": 4,
-                                "loc": {
-                                  "start": {
-                                    "line": 32,
-                                    "column": 16
-                                  },
-                                  "end": {
-                                    "line": 32,
-                                    "column": 17
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 32,
-                                  "column": 7
-                                },
-                                "end": {
-                                  "line": 32,
-                                  "column": 17
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 32,
-                                "column": 7
-                              },
-                              "end": {
-                                "line": 32,
-                                "column": 18
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 31,
-                            "column": 17
-                          },
-                          "end": {
-                            "line": 33,
-                            "column": 6
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 31,
-                          "column": 8
-                        },
-                        "end": {
-                          "line": 33,
-                          "column": 6
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 31,
-                        "column": 8
-                      },
-                      "end": {
-                        "line": 33,
-                        "column": 6
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 31,
-                      "column": 5
-                    },
-                    "end": {
-                      "line": 33,
-                      "column": 6
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 34,
-                      "column": 4
-                    },
-                    "end": {
-                      "line": 34,
-                      "column": 4
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 30,
-                  "column": 11
-                },
-                "end": {
-                  "line": 34,
-                  "column": 4
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 30,
-                "column": 3
-              },
-              "end": {
-                "line": 34,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 35,
-                "column": 2
-              },
-              "end": {
-                "line": 35,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 17,
-            "column": 19
-          },
-          "end": {
-            "line": 35,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 17,
-          "column": 1
-        },
-        "end": {
-          "line": 35,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "a",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 5
-                },
-                "end": {
-                  "line": 1,
-                  "column": 6
-                }
-              }
-            },
-            "value": {
-              "type": "Identifier",
-              "name": "max",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 33
-                },
-                "end": {
-                  "line": 1,
-                  "column": 36
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": true,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSFunctionType",
-              "params": [
-                {
-                  "type": "Identifier",
-                  "name": "a",
-                  "typeAnnotation": {
-                    "type": "ETSPrimitiveType",
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 11
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 14
-                      }
-                    }
-                  },
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 8
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 14
-                    }
-                  }
-                },
-                {
-                  "type": "Identifier",
-                  "name": "b",
-                  "typeAnnotation": {
-                    "type": "ETSPrimitiveType",
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 19
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 22
-                      }
-                    }
-                  },
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 16
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 22
-                    }
-                  }
-                }
-              ],
-              "returnType": {
-                "type": "ETSPrimitiveType",
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 27
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 30
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 7
-                },
-                "end": {
-                  "line": 1,
-                  "column": 30
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "b",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 3,
-                  "column": 5
-                },
-                "end": {
-                  "line": 3,
-                  "column": 6
-                }
-              }
-            },
-            "value": {
-              "type": "StringLiteral",
-              "value": "foo",
-              "loc": {
-                "start": {
-                  "line": 3,
-                  "column": 17
-                },
-                "end": {
-                  "line": 3,
-                  "column": 22
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": true,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSTypeReference",
-              "part": {
-                "type": "ETSTypeReferencePart",
-                "name": {
-                  "type": "Identifier",
-                  "name": "String",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 3,
-                      "column": 8
-                    },
-                    "end": {
-                      "line": 3,
-                      "column": 14
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 3,
-                    "column": 8
-                  },
-                  "end": {
-                    "line": 3,
-                    "column": 16
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 3,
-                  "column": 8
-                },
-                "end": {
-                  "line": 3,
-                  "column": 16
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "bar",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 5,
-                  "column": 10
-                },
-                "end": {
-                  "line": 5,
-                  "column": 13
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": true,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "bar",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 5,
-                      "column": 10
-                    },
-                    "end": {
-                      "line": 5,
-                      "column": 13
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [
-                  {
-                    "type": "Identifier",
-                    "name": "a",
-                    "typeAnnotation": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 5,
-                          "column": 18
-                        },
-                        "end": {
-                          "line": 5,
-                          "column": 21
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 5,
-                        "column": 15
-                      },
-                      "end": {
-                        "line": 5,
-                        "column": 21
-                      }
-                    }
-                  }
-                ],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 5,
-                      "column": 24
-                    },
-                    "end": {
-                      "line": 5,
-                      "column": 28
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 5,
-                      "column": 29
-                    },
-                    "end": {
-                      "line": 7,
-                      "column": 2
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 5,
-                    "column": 14
-                  },
-                  "end": {
-                    "line": 7,
-                    "column": 2
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 5,
-                  "column": 14
-                },
-                "end": {
-                  "line": 7,
-                  "column": 2
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 5,
-                "column": 1
-              },
-              "end": {
-                "line": 7,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 36,
-      "column": 1
-    }
-  }
-}
-TypeError: Property 'b' does not exist on type 'C' [identifierReference1.ets:32:12]
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [identifierReference1.ets:45:3]
diff --git a/ets2panda/test/compiler/ets/identifierReference15-expected.txt b/ets2panda/test/compiler/ets/identifierReference15-expected.txt
index 888dd8d8b5..f90eb8dfdd 100644
--- a/ets2panda/test/compiler/ets/identifierReference15-expected.txt
+++ b/ets2panda/test/compiler/ets/identifierReference15-expected.txt
@@ -1,892 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "A",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 7
-            },
-            "end": {
-              "line": 1,
-              "column": 8
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "foo",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 2,
-                  "column": 3
-                },
-                "end": {
-                  "line": 2,
-                  "column": 6
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "foo",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 2,
-                      "column": 3
-                    },
-                    "end": {
-                      "line": 2,
-                      "column": 6
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [
-                  {
-                    "type": "Identifier",
-                    "name": "a",
-                    "typeAnnotation": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 2,
-                          "column": 10
-                        },
-                        "end": {
-                          "line": 2,
-                          "column": 13
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 2,
-                        "column": 7
-                      },
-                      "end": {
-                        "line": 2,
-                        "column": 13
-                      }
-                    }
-                  }
-                ],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 2,
-                      "column": 16
-                    },
-                    "end": {
-                      "line": 2,
-                      "column": 20
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 2,
-                      "column": 21
-                    },
-                    "end": {
-                      "line": 4,
-                      "column": 4
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 2,
-                    "column": 6
-                  },
-                  "end": {
-                    "line": 4,
-                    "column": 4
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 2,
-                  "column": 6
-                },
-                "end": {
-                  "line": 4,
-                  "column": 4
-                }
-              }
-            },
-            "overloads": [
-              {
-                "type": "MethodDefinition",
-                "key": {
-                  "type": "Identifier",
-                  "name": "foo",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 6,
-                      "column": 3
-                    },
-                    "end": {
-                      "line": 6,
-                      "column": 6
-                    }
-                  }
-                },
-                "kind": "method",
-                "accessibility": "public",
-                "static": false,
-                "optional": false,
-                "computed": false,
-                "value": {
-                  "type": "FunctionExpression",
-                  "function": {
-                    "type": "ScriptFunction",
-                    "id": {
-                      "type": "Identifier",
-                      "name": "foo",
-                      "decorators": [],
-                      "loc": {
-                        "start": {
-                          "line": 6,
-                          "column": 3
-                        },
-                        "end": {
-                          "line": 6,
-                          "column": 6
-                        }
-                      }
-                    },
-                    "generator": false,
-                    "async": false,
-                    "expression": false,
-                    "params": [],
-                    "returnType": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 6,
-                          "column": 10
-                        },
-                        "end": {
-                          "line": 6,
-                          "column": 14
-                        }
-                      }
-                    },
-                    "body": {
-                      "type": "BlockStatement",
-                      "statements": [],
-                      "loc": {
-                        "start": {
-                          "line": 6,
-                          "column": 15
-                        },
-                        "end": {
-                          "line": 8,
-                          "column": 4
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 6,
-                        "column": 6
-                      },
-                      "end": {
-                        "line": 8,
-                        "column": 4
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 6,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 8,
-                      "column": 4
-                    }
-                  }
-                },
-                "overloads": [],
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 6,
-                    "column": 3
-                  },
-                  "end": {
-                    "line": 8,
-                    "column": 4
-                  }
-                }
-              }
-            ],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 2,
-                "column": 3
-              },
-              "end": {
-                "line": 4,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "B",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 10,
-                    "column": 9
-                  },
-                  "end": {
-                    "line": 10,
-                    "column": 10
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "foo",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 11,
-                        "column": 5
-                      },
-                      "end": {
-                        "line": 11,
-                        "column": 8
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "foo",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 11,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 11,
-                            "column": 8
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [
-                        {
-                          "type": "Identifier",
-                          "name": "a",
-                          "typeAnnotation": {
-                            "type": "ETSPrimitiveType",
-                            "loc": {
-                              "start": {
-                                "line": 11,
-                                "column": 12
-                              },
-                              "end": {
-                                "line": 11,
-                                "column": 15
-                              }
-                            }
-                          },
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 11,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 11,
-                              "column": 15
-                            }
-                          }
-                        }
-                      ],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 11,
-                            "column": 18
-                          },
-                          "end": {
-                            "line": 11,
-                            "column": 22
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 11,
-                            "column": 23
-                          },
-                          "end": {
-                            "line": 13,
-                            "column": 6
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 11,
-                          "column": 8
-                        },
-                        "end": {
-                          "line": 13,
-                          "column": 6
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 11,
-                        "column": 8
-                      },
-                      "end": {
-                        "line": 13,
-                        "column": 6
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 11,
-                      "column": 5
-                    },
-                    "end": {
-                      "line": 13,
-                      "column": 6
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "baz",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 15,
-                        "column": 5
-                      },
-                      "end": {
-                        "line": 15,
-                        "column": 8
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "baz",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 15,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 15,
-                            "column": 8
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 15,
-                            "column": 12
-                          },
-                          "end": {
-                            "line": 15,
-                            "column": 16
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "CallExpression",
-                              "callee": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "ThisExpression",
-                                  "loc": {
-                                    "start": {
-                                      "line": 16,
-                                      "column": 7
-                                    },
-                                    "end": {
-                                      "line": 16,
-                                      "column": 11
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "foo",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 16,
-                                      "column": 12
-                                    },
-                                    "end": {
-                                      "line": 16,
-                                      "column": 15
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 16,
-                                    "column": 7
-                                  },
-                                  "end": {
-                                    "line": 16,
-                                    "column": 15
-                                  }
-                                }
-                              },
-                              "arguments": [],
-                              "optional": false,
-                              "loc": {
-                                "start": {
-                                  "line": 16,
-                                  "column": 7
-                                },
-                                "end": {
-                                  "line": 16,
-                                  "column": 17
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 16,
-                                "column": 7
-                              },
-                              "end": {
-                                "line": 16,
-                                "column": 18
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 15,
-                            "column": 17
-                          },
-                          "end": {
-                            "line": 17,
-                            "column": 6
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 15,
-                          "column": 8
-                        },
-                        "end": {
-                          "line": 17,
-                          "column": 6
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 15,
-                        "column": 8
-                      },
-                      "end": {
-                        "line": 17,
-                        "column": 6
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 15,
-                      "column": 5
-                    },
-                    "end": {
-                      "line": 17,
-                      "column": 6
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 18,
-                      "column": 4
-                    },
-                    "end": {
-                      "line": 18,
-                      "column": 4
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 10,
-                  "column": 11
-                },
-                "end": {
-                  "line": 18,
-                  "column": 4
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 10,
-                "column": 3
-              },
-              "end": {
-                "line": 18,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 19,
-                "column": 2
-              },
-              "end": {
-                "line": 19,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 9
-          },
-          "end": {
-            "line": 19,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 19,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 20,
-      "column": 1
-    }
-  }
-}
-TypeError: No matching call signature [identifierReference15.ets:16:7]
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [identifierReference15.ets:25:3]
diff --git a/ets2panda/test/compiler/ets/identifierReference16-expected.txt b/ets2panda/test/compiler/ets/identifierReference16-expected.txt
index a94ef69ecf..292343f60c 100644
--- a/ets2panda/test/compiler/ets/identifierReference16-expected.txt
+++ b/ets2panda/test/compiler/ets/identifierReference16-expected.txt
@@ -1,1396 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "B",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 12
-            },
-            "end": {
-              "line": 1,
-              "column": 13
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "foo",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 2,
-                  "column": 3
-                },
-                "end": {
-                  "line": 2,
-                  "column": 6
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "foo",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 2,
-                      "column": 3
-                    },
-                    "end": {
-                      "line": 2,
-                      "column": 6
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [
-                  {
-                    "type": "Identifier",
-                    "name": "a",
-                    "typeAnnotation": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 2,
-                          "column": 10
-                        },
-                        "end": {
-                          "line": 2,
-                          "column": 13
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 2,
-                        "column": 7
-                      },
-                      "end": {
-                        "line": 2,
-                        "column": 13
-                      }
-                    }
-                  }
-                ],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 2,
-                      "column": 16
-                    },
-                    "end": {
-                      "line": 2,
-                      "column": 20
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 2,
-                      "column": 21
-                    },
-                    "end": {
-                      "line": 4,
-                      "column": 4
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 2,
-                    "column": 6
-                  },
-                  "end": {
-                    "line": 4,
-                    "column": 4
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 2,
-                  "column": 6
-                },
-                "end": {
-                  "line": 4,
-                  "column": 4
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 2,
-                "column": 3
-              },
-              "end": {
-                "line": 4,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 5,
-                "column": 2
-              },
-              "end": {
-                "line": 5,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 14
-          },
-          "end": {
-            "line": 5,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 6
-        },
-        "end": {
-          "line": 5,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "C",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 7,
-              "column": 12
-            },
-            "end": {
-              "line": 7,
-              "column": 13
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 9,
-                "column": 2
-              },
-              "end": {
-                "line": 9,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 7,
-            "column": 14
-          },
-          "end": {
-            "line": 9,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 7,
-          "column": 6
-        },
-        "end": {
-          "line": 9,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "A",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 11,
-              "column": 7
-            },
-            "end": {
-              "line": 11,
-              "column": 8
-            }
-          }
-        },
-        "superClass": {
-          "type": "ETSTypeReference",
-          "part": {
-            "type": "ETSTypeReferencePart",
-            "name": {
-              "type": "Identifier",
-              "name": "B",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 11,
-                  "column": 17
-                },
-                "end": {
-                  "line": 11,
-                  "column": 18
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 11,
-                "column": 17
-              },
-              "end": {
-                "line": 11,
-                "column": 20
-              }
-            }
-          },
-          "loc": {
-            "start": {
-              "line": 11,
-              "column": 17
-            },
-            "end": {
-              "line": 11,
-              "column": 20
-            }
-          }
-        },
-        "implements": [],
-        "body": [
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "foo",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 12,
-                  "column": 3
-                },
-                "end": {
-                  "line": 12,
-                  "column": 6
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "foo",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 12,
-                      "column": 3
-                    },
-                    "end": {
-                      "line": 12,
-                      "column": 6
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [
-                  {
-                    "type": "Identifier",
-                    "name": "a",
-                    "typeAnnotation": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 12,
-                          "column": 10
-                        },
-                        "end": {
-                          "line": 12,
-                          "column": 13
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 12,
-                        "column": 7
-                      },
-                      "end": {
-                        "line": 12,
-                        "column": 13
-                      }
-                    }
-                  },
-                  {
-                    "type": "Identifier",
-                    "name": "b",
-                    "typeAnnotation": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 12,
-                          "column": 18
-                        },
-                        "end": {
-                          "line": 12,
-                          "column": 21
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 12,
-                        "column": 15
-                      },
-                      "end": {
-                        "line": 12,
-                        "column": 21
-                      }
-                    }
-                  }
-                ],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 12,
-                      "column": 24
-                    },
-                    "end": {
-                      "line": 12,
-                      "column": 28
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 12,
-                      "column": 29
-                    },
-                    "end": {
-                      "line": 14,
-                      "column": 4
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 12,
-                    "column": 6
-                  },
-                  "end": {
-                    "line": 14,
-                    "column": 4
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 12,
-                  "column": 6
-                },
-                "end": {
-                  "line": 14,
-                  "column": 4
-                }
-              }
-            },
-            "overloads": [
-              {
-                "type": "MethodDefinition",
-                "key": {
-                  "type": "Identifier",
-                  "name": "foo",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 16,
-                      "column": 3
-                    },
-                    "end": {
-                      "line": 16,
-                      "column": 6
-                    }
-                  }
-                },
-                "kind": "method",
-                "accessibility": "public",
-                "static": false,
-                "optional": false,
-                "computed": false,
-                "value": {
-                  "type": "FunctionExpression",
-                  "function": {
-                    "type": "ScriptFunction",
-                    "id": {
-                      "type": "Identifier",
-                      "name": "foo",
-                      "decorators": [],
-                      "loc": {
-                        "start": {
-                          "line": 16,
-                          "column": 3
-                        },
-                        "end": {
-                          "line": 16,
-                          "column": 6
-                        }
-                      }
-                    },
-                    "generator": false,
-                    "async": false,
-                    "expression": false,
-                    "params": [],
-                    "returnType": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 16,
-                          "column": 10
-                        },
-                        "end": {
-                          "line": 16,
-                          "column": 14
-                        }
-                      }
-                    },
-                    "body": {
-                      "type": "BlockStatement",
-                      "statements": [],
-                      "loc": {
-                        "start": {
-                          "line": 16,
-                          "column": 15
-                        },
-                        "end": {
-                          "line": 18,
-                          "column": 4
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 16,
-                        "column": 6
-                      },
-                      "end": {
-                        "line": 18,
-                        "column": 4
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 16,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 18,
-                      "column": 4
-                    }
-                  }
-                },
-                "overloads": [],
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 16,
-                    "column": 3
-                  },
-                  "end": {
-                    "line": 18,
-                    "column": 4
-                  }
-                }
-              }
-            ],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 12,
-                "column": 3
-              },
-              "end": {
-                "line": 14,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "D",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 20,
-                    "column": 9
-                  },
-                  "end": {
-                    "line": 20,
-                    "column": 10
-                  }
-                }
-              },
-              "superClass": {
-                "type": "ETSTypeReference",
-                "part": {
-                  "type": "ETSTypeReferencePart",
-                  "name": {
-                    "type": "Identifier",
-                    "name": "C",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 20,
-                        "column": 19
-                      },
-                      "end": {
-                        "line": 20,
-                        "column": 20
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 20,
-                      "column": 19
-                    },
-                    "end": {
-                      "line": 20,
-                      "column": 22
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 20,
-                    "column": 19
-                  },
-                  "end": {
-                    "line": 20,
-                    "column": 22
-                  }
-                }
-              },
-              "implements": [],
-              "body": [
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "foo",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 21,
-                        "column": 5
-                      },
-                      "end": {
-                        "line": 21,
-                        "column": 8
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "foo",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 21,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 21,
-                            "column": 8
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 21,
-                            "column": 12
-                          },
-                          "end": {
-                            "line": 21,
-                            "column": 16
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 21,
-                            "column": 17
-                          },
-                          "end": {
-                            "line": 23,
-                            "column": 6
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 21,
-                          "column": 8
-                        },
-                        "end": {
-                          "line": 23,
-                          "column": 6
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 21,
-                        "column": 8
-                      },
-                      "end": {
-                        "line": 23,
-                        "column": 6
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 21,
-                      "column": 5
-                    },
-                    "end": {
-                      "line": 23,
-                      "column": 6
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "baz",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 25,
-                        "column": 5
-                      },
-                      "end": {
-                        "line": 25,
-                        "column": 8
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "baz",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 25,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 25,
-                            "column": 8
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 25,
-                            "column": 12
-                          },
-                          "end": {
-                            "line": 25,
-                            "column": 16
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "CallExpression",
-                              "callee": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "ThisExpression",
-                                  "loc": {
-                                    "start": {
-                                      "line": 26,
-                                      "column": 7
-                                    },
-                                    "end": {
-                                      "line": 26,
-                                      "column": 11
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "foo",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 26,
-                                      "column": 12
-                                    },
-                                    "end": {
-                                      "line": 26,
-                                      "column": 15
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 26,
-                                    "column": 7
-                                  },
-                                  "end": {
-                                    "line": 26,
-                                    "column": 15
-                                  }
-                                }
-                              },
-                              "arguments": [
-                                {
-                                  "type": "NumberLiteral",
-                                  "value": 1,
-                                  "loc": {
-                                    "start": {
-                                      "line": 26,
-                                      "column": 16
-                                    },
-                                    "end": {
-                                      "line": 26,
-                                      "column": 17
-                                    }
-                                  }
-                                }
-                              ],
-                              "optional": false,
-                              "loc": {
-                                "start": {
-                                  "line": 26,
-                                  "column": 7
-                                },
-                                "end": {
-                                  "line": 26,
-                                  "column": 18
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 26,
-                                "column": 7
-                              },
-                              "end": {
-                                "line": 26,
-                                "column": 19
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 25,
-                            "column": 17
-                          },
-                          "end": {
-                            "line": 27,
-                            "column": 6
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 25,
-                          "column": 8
-                        },
-                        "end": {
-                          "line": 27,
-                          "column": 6
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 25,
-                        "column": 8
-                      },
-                      "end": {
-                        "line": 27,
-                        "column": 6
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 25,
-                      "column": 5
-                    },
-                    "end": {
-                      "line": 27,
-                      "column": 6
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 28,
-                      "column": 4
-                    },
-                    "end": {
-                      "line": 28,
-                      "column": 4
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 20,
-                  "column": 21
-                },
-                "end": {
-                  "line": 28,
-                  "column": 4
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 20,
-                "column": 3
-              },
-              "end": {
-                "line": 28,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 29,
-                "column": 2
-              },
-              "end": {
-                "line": 29,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 11,
-            "column": 19
-          },
-          "end": {
-            "line": 29,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 11,
-          "column": 1
-        },
-        "end": {
-          "line": 29,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 30,
-      "column": 1
-    }
-  }
-}
-TypeError: No matching call signature [identifierReference16.ets:26:7]
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [identifierReference16.ets:35:3]
diff --git a/ets2panda/test/compiler/ets/identifierReference6-expected.txt b/ets2panda/test/compiler/ets/identifierReference6-expected.txt
index f2cea78672..f1e23a8849 100644
--- a/ets2panda/test/compiler/ets/identifierReference6-expected.txt
+++ b/ets2panda/test/compiler/ets/identifierReference6-expected.txt
@@ -1,575 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "A",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 2,
-              "column": 7
-            },
-            "end": {
-              "line": 2,
-              "column": 8
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "a",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 3,
-                  "column": 3
-                },
-                "end": {
-                  "line": 3,
-                  "column": 4
-                }
-              }
-            },
-            "value": {
-              "type": "NumberLiteral",
-              "value": 2,
-              "loc": {
-                "start": {
-                  "line": 3,
-                  "column": 12
-                },
-                "end": {
-                  "line": 3,
-                  "column": 13
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": false,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSPrimitiveType",
-              "loc": {
-                "start": {
-                  "line": 3,
-                  "column": 6
-                },
-                "end": {
-                  "line": 3,
-                  "column": 9
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "B",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 5,
-                    "column": 16
-                  },
-                  "end": {
-                    "line": 5,
-                    "column": 17
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "foo",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 6,
-                        "column": 5
-                      },
-                      "end": {
-                        "line": 6,
-                        "column": 8
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "foo",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 6,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 6,
-                            "column": 8
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 6,
-                            "column": 12
-                          },
-                          "end": {
-                            "line": 6,
-                            "column": 16
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "UpdateExpression",
-                              "operator": "++",
-                              "prefix": false,
-                              "argument": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "ThisExpression",
-                                  "loc": {
-                                    "start": {
-                                      "line": 7,
-                                      "column": 7
-                                    },
-                                    "end": {
-                                      "line": 7,
-                                      "column": 11
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "a",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 7,
-                                      "column": 12
-                                    },
-                                    "end": {
-                                      "line": 7,
-                                      "column": 13
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 7,
-                                    "column": 7
-                                  },
-                                  "end": {
-                                    "line": 7,
-                                    "column": 13
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 7,
-                                  "column": 7
-                                },
-                                "end": {
-                                  "line": 7,
-                                  "column": 15
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 7,
-                                "column": 7
-                              },
-                              "end": {
-                                "line": 7,
-                                "column": 16
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 6,
-                            "column": 17
-                          },
-                          "end": {
-                            "line": 8,
-                            "column": 6
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 6,
-                          "column": 8
-                        },
-                        "end": {
-                          "line": 8,
-                          "column": 6
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 6,
-                        "column": 8
-                      },
-                      "end": {
-                        "line": 8,
-                        "column": 6
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 6,
-                      "column": 5
-                    },
-                    "end": {
-                      "line": 8,
-                      "column": 6
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 9,
-                      "column": 4
-                    },
-                    "end": {
-                      "line": 9,
-                      "column": 4
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 5,
-                  "column": 18
-                },
-                "end": {
-                  "line": 9,
-                  "column": 4
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 5,
-                "column": 10
-              },
-              "end": {
-                "line": 9,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 10,
-                "column": 2
-              },
-              "end": {
-                "line": 10,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 2,
-            "column": 9
-          },
-          "end": {
-            "line": 10,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 2,
-          "column": 1
-        },
-        "end": {
-          "line": 10,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 11,
-      "column": 1
-    }
-  }
-}
-TypeError: 'this' cannot be referenced from a static context [identifierReference6.ets:7:7]
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [identifierReference6.ets:19:10]
diff --git a/ets2panda/test/compiler/ets/identifierReference7-expected.txt b/ets2panda/test/compiler/ets/identifierReference7-expected.txt
index 5ff90818b1..c1c52eb11f 100644
--- a/ets2panda/test/compiler/ets/identifierReference7-expected.txt
+++ b/ets2panda/test/compiler/ets/identifierReference7-expected.txt
@@ -1,829 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "C",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 2,
-              "column": 12
-            },
-            "end": {
-              "line": 2,
-              "column": 13
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "a",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 3,
-                  "column": 3
-                },
-                "end": {
-                  "line": 3,
-                  "column": 4
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": false,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSTypeReference",
-              "part": {
-                "type": "ETSTypeReferencePart",
-                "name": {
-                  "type": "Identifier",
-                  "name": "Object",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 3,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 3,
-                      "column": 12
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 3,
-                    "column": 6
-                  },
-                  "end": {
-                    "line": 3,
-                    "column": 13
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 3,
-                  "column": 6
-                },
-                "end": {
-                  "line": 3,
-                  "column": 13
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 4,
-                "column": 2
-              },
-              "end": {
-                "line": 4,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 2,
-            "column": 14
-          },
-          "end": {
-            "line": 4,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 2,
-          "column": 6
-        },
-        "end": {
-          "line": 4,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "A",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 6,
-              "column": 7
-            },
-            "end": {
-              "line": 6,
-              "column": 8
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "a",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 7,
-                  "column": 3
-                },
-                "end": {
-                  "line": 7,
-                  "column": 4
-                }
-              }
-            },
-            "value": {
-              "type": "NumberLiteral",
-              "value": 2,
-              "loc": {
-                "start": {
-                  "line": 7,
-                  "column": 12
-                },
-                "end": {
-                  "line": 7,
-                  "column": 13
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": false,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSPrimitiveType",
-              "loc": {
-                "start": {
-                  "line": 7,
-                  "column": 6
-                },
-                "end": {
-                  "line": 7,
-                  "column": 9
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "B",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 9,
-                    "column": 9
-                  },
-                  "end": {
-                    "line": 9,
-                    "column": 10
-                  }
-                }
-              },
-              "superClass": {
-                "type": "ETSTypeReference",
-                "part": {
-                  "type": "ETSTypeReferencePart",
-                  "name": {
-                    "type": "Identifier",
-                    "name": "C",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 9,
-                        "column": 19
-                      },
-                      "end": {
-                        "line": 9,
-                        "column": 20
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 9,
-                      "column": 19
-                    },
-                    "end": {
-                      "line": 9,
-                      "column": 22
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 9,
-                    "column": 19
-                  },
-                  "end": {
-                    "line": 9,
-                    "column": 22
-                  }
-                }
-              },
-              "implements": [],
-              "body": [
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "foo",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 10,
-                        "column": 5
-                      },
-                      "end": {
-                        "line": 10,
-                        "column": 8
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "foo",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 10,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 10,
-                            "column": 8
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 10,
-                            "column": 12
-                          },
-                          "end": {
-                            "line": 10,
-                            "column": 16
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "UpdateExpression",
-                              "operator": "++",
-                              "prefix": false,
-                              "argument": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "ThisExpression",
-                                  "loc": {
-                                    "start": {
-                                      "line": 11,
-                                      "column": 7
-                                    },
-                                    "end": {
-                                      "line": 11,
-                                      "column": 11
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "a",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 11,
-                                      "column": 12
-                                    },
-                                    "end": {
-                                      "line": 11,
-                                      "column": 13
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 11,
-                                    "column": 7
-                                  },
-                                  "end": {
-                                    "line": 11,
-                                    "column": 13
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 11,
-                                  "column": 7
-                                },
-                                "end": {
-                                  "line": 11,
-                                  "column": 15
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 11,
-                                "column": 7
-                              },
-                              "end": {
-                                "line": 11,
-                                "column": 16
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 10,
-                            "column": 17
-                          },
-                          "end": {
-                            "line": 12,
-                            "column": 6
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 10,
-                          "column": 8
-                        },
-                        "end": {
-                          "line": 12,
-                          "column": 6
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 10,
-                        "column": 8
-                      },
-                      "end": {
-                        "line": 12,
-                        "column": 6
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 10,
-                      "column": 5
-                    },
-                    "end": {
-                      "line": 12,
-                      "column": 6
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 13,
-                      "column": 4
-                    },
-                    "end": {
-                      "line": 13,
-                      "column": 4
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 9,
-                  "column": 21
-                },
-                "end": {
-                  "line": 13,
-                  "column": 4
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 9,
-                "column": 3
-              },
-              "end": {
-                "line": 13,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 14,
-                "column": 2
-              },
-              "end": {
-                "line": 14,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 6,
-            "column": 9
-          },
-          "end": {
-            "line": 14,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 6,
-          "column": 1
-        },
-        "end": {
-          "line": 14,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 15,
-      "column": 1
-    }
-  }
-}
-TypeError: Bad operand type, the type of the operand must be numeric type. [identifierReference7.ets:11:7]
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [identifierReference7.ets:23:3]
diff --git a/ets2panda/test/compiler/ets/invalidInheritance2-expected.txt b/ets2panda/test/compiler/ets/invalidInheritance2-expected.txt
index cd295e75f1..de48ad4ea2 100644
--- a/ets2panda/test/compiler/ets/invalidInheritance2-expected.txt
+++ b/ets2panda/test/compiler/ets/invalidInheritance2-expected.txt
@@ -1,750 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "A",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 12
-            },
-            "end": {
-              "line": 1,
-              "column": 13
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "a",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 2,
-                  "column": 5
-                },
-                "end": {
-                  "line": 2,
-                  "column": 6
-                }
-              }
-            },
-            "value": {
-              "type": "NumberLiteral",
-              "value": 1,
-              "loc": {
-                "start": {
-                  "line": 2,
-                  "column": 14
-                },
-                "end": {
-                  "line": 2,
-                  "column": 15
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": false,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSPrimitiveType",
-              "loc": {
-                "start": {
-                  "line": 2,
-                  "column": 8
-                },
-                "end": {
-                  "line": 2,
-                  "column": 11
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 3,
-                "column": 2
-              },
-              "end": {
-                "line": 3,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 14
-          },
-          "end": {
-            "line": 3,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 6
-        },
-        "end": {
-          "line": 3,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "B",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 5,
-              "column": 12
-            },
-            "end": {
-              "line": 5,
-              "column": 13
-            }
-          }
-        },
-        "superClass": {
-          "type": "ETSTypeReference",
-          "part": {
-            "type": "ETSTypeReferencePart",
-            "name": {
-              "type": "Identifier",
-              "name": "A",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 5,
-                  "column": 22
-                },
-                "end": {
-                  "line": 5,
-                  "column": 23
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 5,
-                "column": 22
-              },
-              "end": {
-                "line": 5,
-                "column": 25
-              }
-            }
-          },
-          "loc": {
-            "start": {
-              "line": 5,
-              "column": 22
-            },
-            "end": {
-              "line": 5,
-              "column": 25
-            }
-          }
-        },
-        "implements": [],
-        "body": [
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 6,
-                "column": 2
-              },
-              "end": {
-                "line": 6,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 5,
-            "column": 24
-          },
-          "end": {
-            "line": 6,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 5,
-          "column": 6
-        },
-        "end": {
-          "line": 6,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "C",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 8,
-              "column": 7
-            },
-            "end": {
-              "line": 8,
-              "column": 8
-            }
-          }
-        },
-        "superClass": {
-          "type": "ETSTypeReference",
-          "part": {
-            "type": "ETSTypeReferencePart",
-            "name": {
-              "type": "Identifier",
-              "name": "B",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 8,
-                  "column": 17
-                },
-                "end": {
-                  "line": 8,
-                  "column": 18
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 8,
-                "column": 17
-              },
-              "end": {
-                "line": 8,
-                "column": 20
-              }
-            }
-          },
-          "loc": {
-            "start": {
-              "line": 8,
-              "column": 17
-            },
-            "end": {
-              "line": 8,
-              "column": 20
-            }
-          }
-        },
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "a",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 9,
-                    "column": 11
-                  },
-                  "end": {
-                    "line": 9,
-                    "column": 12
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 11,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 11,
-                      "column": 6
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 9,
-                  "column": 13
-                },
-                "end": {
-                  "line": 11,
-                  "column": 6
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 9,
-                "column": 5
-              },
-              "end": {
-                "line": 11,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 12,
-                "column": 2
-              },
-              "end": {
-                "line": 12,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 8,
-            "column": 19
-          },
-          "end": {
-            "line": 12,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 8,
-          "column": 1
-        },
-        "end": {
-          "line": 12,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 13,
-      "column": 1
-    }
-  }
-}
-TypeError: Cannot inherit from class B, because class a is inherited with a different declaration type [invalidInheritance2.ets:8:17]
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [invalidInheritance2.ets:24:5]
diff --git a/ets2panda/test/compiler/ets/invalidPrivateAccess5-expected.txt b/ets2panda/test/compiler/ets/invalidPrivateAccess5-expected.txt
index 545b5159fd..93ceff48c7 100644
--- a/ets2panda/test/compiler/ets/invalidPrivateAccess5-expected.txt
+++ b/ets2panda/test/compiler/ets/invalidPrivateAccess5-expected.txt
@@ -1,1009 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "Outer",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 7
-            },
-            "end": {
-              "line": 1,
-              "column": 12
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "Base",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 2,
-                    "column": 16
-                  },
-                  "end": {
-                    "line": 2,
-                    "column": 20
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "a",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 3,
-                        "column": 17
-                      },
-                      "end": {
-                        "line": 3,
-                        "column": 18
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "private",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "a",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 3,
-                            "column": 17
-                          },
-                          "end": {
-                            "line": 3,
-                            "column": 18
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 3,
-                            "column": 22
-                          },
-                          "end": {
-                            "line": 3,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 3,
-                            "column": 27
-                          },
-                          "end": {
-                            "line": 3,
-                            "column": 29
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 3,
-                          "column": 18
-                        },
-                        "end": {
-                          "line": 3,
-                          "column": 29
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 3,
-                        "column": 18
-                      },
-                      "end": {
-                        "line": 3,
-                        "column": 29
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 3,
-                      "column": 9
-                    },
-                    "end": {
-                      "line": 3,
-                      "column": 29
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 4,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 4,
-                      "column": 6
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 2,
-                  "column": 21
-                },
-                "end": {
-                  "line": 4,
-                  "column": 6
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 2,
-                "column": 10
-              },
-              "end": {
-                "line": 4,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "Derived",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 6,
-                    "column": 11
-                  },
-                  "end": {
-                    "line": 6,
-                    "column": 18
-                  }
-                }
-              },
-              "superClass": {
-                "type": "ETSTypeReference",
-                "part": {
-                  "type": "ETSTypeReferencePart",
-                  "name": {
-                    "type": "Identifier",
-                    "name": "Base",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 6,
-                        "column": 27
-                      },
-                      "end": {
-                        "line": 6,
-                        "column": 31
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 6,
-                      "column": 27
-                    },
-                    "end": {
-                      "line": 6,
-                      "column": 33
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 6,
-                    "column": 27
-                  },
-                  "end": {
-                    "line": 6,
-                    "column": 33
-                  }
-                }
-              },
-              "implements": [],
-              "body": [
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "foo",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 7,
-                        "column": 9
-                      },
-                      "end": {
-                        "line": 7,
-                        "column": 12
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "foo",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 7,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 7,
-                            "column": 12
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 7,
-                            "column": 16
-                          },
-                          "end": {
-                            "line": 7,
-                            "column": 20
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "VariableDeclaration",
-                            "declarations": [
-                              {
-                                "type": "VariableDeclarator",
-                                "id": {
-                                  "type": "Identifier",
-                                  "name": "base",
-                                  "typeAnnotation": {
-                                    "type": "ETSTypeReference",
-                                    "part": {
-                                      "type": "ETSTypeReferencePart",
-                                      "name": {
-                                        "type": "Identifier",
-                                        "name": "Base",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 8,
-                                            "column": 23
-                                          },
-                                          "end": {
-                                            "line": 8,
-                                            "column": 27
-                                          }
-                                        }
-                                      },
-                                      "loc": {
-                                        "start": {
-                                          "line": 8,
-                                          "column": 23
-                                        },
-                                        "end": {
-                                          "line": 8,
-                                          "column": 29
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 8,
-                                        "column": 23
-                                      },
-                                      "end": {
-                                        "line": 8,
-                                        "column": 29
-                                      }
-                                    }
-                                  },
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 8,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 8,
-                                      "column": 21
-                                    }
-                                  }
-                                },
-                                "init": {
-                                  "type": "ETSNewClassInstanceExpression",
-                                  "typeReference": {
-                                    "type": "ETSTypeReference",
-                                    "part": {
-                                      "type": "ETSTypeReferencePart",
-                                      "name": {
-                                        "type": "Identifier",
-                                        "name": "Base",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 8,
-                                            "column": 34
-                                          },
-                                          "end": {
-                                            "line": 8,
-                                            "column": 38
-                                          }
-                                        }
-                                      },
-                                      "loc": {
-                                        "start": {
-                                          "line": 8,
-                                          "column": 34
-                                        },
-                                        "end": {
-                                          "line": 8,
-                                          "column": 39
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 8,
-                                        "column": 34
-                                      },
-                                      "end": {
-                                        "line": 8,
-                                        "column": 39
-                                      }
-                                    }
-                                  },
-                                  "arguments": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 8,
-                                      "column": 30
-                                    },
-                                    "end": {
-                                      "line": 8,
-                                      "column": 41
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 8,
-                                    "column": 17
-                                  },
-                                  "end": {
-                                    "line": 8,
-                                    "column": 41
-                                  }
-                                }
-                              }
-                            ],
-                            "kind": "let",
-                            "loc": {
-                              "start": {
-                                "line": 8,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 8,
-                                "column": 41
-                              }
-                            }
-                          },
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "CallExpression",
-                              "callee": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "Identifier",
-                                  "name": "base",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 9,
-                                      "column": 13
-                                    },
-                                    "end": {
-                                      "line": 9,
-                                      "column": 17
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "a",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 9,
-                                      "column": 18
-                                    },
-                                    "end": {
-                                      "line": 9,
-                                      "column": 19
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 9,
-                                    "column": 13
-                                  },
-                                  "end": {
-                                    "line": 9,
-                                    "column": 19
-                                  }
-                                }
-                              },
-                              "arguments": [],
-                              "optional": false,
-                              "loc": {
-                                "start": {
-                                  "line": 9,
-                                  "column": 13
-                                },
-                                "end": {
-                                  "line": 9,
-                                  "column": 21
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 9,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 9,
-                                "column": 22
-                              }
-                            }
-                          },
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "CallExpression",
-                              "callee": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "ThisExpression",
-                                  "loc": {
-                                    "start": {
-                                      "line": 10,
-                                      "column": 13
-                                    },
-                                    "end": {
-                                      "line": 10,
-                                      "column": 17
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "a",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 10,
-                                      "column": 18
-                                    },
-                                    "end": {
-                                      "line": 10,
-                                      "column": 19
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 10,
-                                    "column": 13
-                                  },
-                                  "end": {
-                                    "line": 10,
-                                    "column": 19
-                                  }
-                                }
-                              },
-                              "arguments": [],
-                              "optional": false,
-                              "loc": {
-                                "start": {
-                                  "line": 10,
-                                  "column": 13
-                                },
-                                "end": {
-                                  "line": 10,
-                                  "column": 21
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 10,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 10,
-                                "column": 22
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 7,
-                            "column": 21
-                          },
-                          "end": {
-                            "line": 11,
-                            "column": 10
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 7,
-                          "column": 12
-                        },
-                        "end": {
-                          "line": 11,
-                          "column": 10
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 7,
-                        "column": 12
-                      },
-                      "end": {
-                        "line": 11,
-                        "column": 10
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 7,
-                      "column": 9
-                    },
-                    "end": {
-                      "line": 11,
-                      "column": 10
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 12,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 12,
-                      "column": 6
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 6,
-                  "column": 32
-                },
-                "end": {
-                  "line": 12,
-                  "column": 6
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 6,
-                "column": 5
-              },
-              "end": {
-                "line": 12,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 13,
-                "column": 2
-              },
-              "end": {
-                "line": 13,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 13
-          },
-          "end": {
-            "line": 13,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 13,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 14,
-      "column": 1
-    }
-  }
-}
-TypeError: Signature a(): void is not visible here. [invalidPrivateAccess5.ets:10:13]
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [invalidPrivateAccess5.ets:17:5]
diff --git a/ets2panda/test/compiler/ets/invalidPrivateAccess6-expected.txt b/ets2panda/test/compiler/ets/invalidPrivateAccess6-expected.txt
index 7fa94c600b..d70beb714c 100644
--- a/ets2panda/test/compiler/ets/invalidPrivateAccess6-expected.txt
+++ b/ets2panda/test/compiler/ets/invalidPrivateAccess6-expected.txt
@@ -1,1538 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "Outer",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 7
-            },
-            "end": {
-              "line": 1,
-              "column": 12
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "A",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 2,
-                    "column": 11
-                  },
-                  "end": {
-                    "line": 2,
-                    "column": 12
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "ClassProperty",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "a",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 3,
-                        "column": 17
-                      },
-                      "end": {
-                        "line": 3,
-                        "column": 18
-                      }
-                    }
-                  },
-                  "value": {
-                    "type": "NumberLiteral",
-                    "value": 12,
-                    "loc": {
-                      "start": {
-                        "line": 3,
-                        "column": 26
-                      },
-                      "end": {
-                        "line": 3,
-                        "column": 28
-                      }
-                    }
-                  },
-                  "accessibility": "private",
-                  "static": false,
-                  "readonly": false,
-                  "declare": false,
-                  "optional": false,
-                  "computed": false,
-                  "typeAnnotation": {
-                    "type": "ETSPrimitiveType",
-                    "loc": {
-                      "start": {
-                        "line": 3,
-                        "column": 20
-                      },
-                      "end": {
-                        "line": 3,
-                        "column": 23
-                      }
-                    }
-                  },
-                  "definite": false,
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 4,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 4,
-                      "column": 6
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 2,
-                  "column": 13
-                },
-                "end": {
-                  "line": 4,
-                  "column": 6
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 2,
-                "column": 5
-              },
-              "end": {
-                "line": 4,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "B",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 6,
-                    "column": 11
-                  },
-                  "end": {
-                    "line": 6,
-                    "column": 12
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "foo",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 7,
-                        "column": 9
-                      },
-                      "end": {
-                        "line": 7,
-                        "column": 12
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "foo",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 7,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 7,
-                            "column": 12
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 7,
-                            "column": 16
-                          },
-                          "end": {
-                            "line": 7,
-                            "column": 20
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "VariableDeclaration",
-                            "declarations": [
-                              {
-                                "type": "VariableDeclarator",
-                                "id": {
-                                  "type": "Identifier",
-                                  "name": "a",
-                                  "typeAnnotation": {
-                                    "type": "ETSTypeReference",
-                                    "part": {
-                                      "type": "ETSTypeReferencePart",
-                                      "name": {
-                                        "type": "Identifier",
-                                        "name": "A",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 8,
-                                            "column": 20
-                                          },
-                                          "end": {
-                                            "line": 8,
-                                            "column": 21
-                                          }
-                                        }
-                                      },
-                                      "loc": {
-                                        "start": {
-                                          "line": 8,
-                                          "column": 20
-                                        },
-                                        "end": {
-                                          "line": 8,
-                                          "column": 23
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 8,
-                                        "column": 20
-                                      },
-                                      "end": {
-                                        "line": 8,
-                                        "column": 23
-                                      }
-                                    }
-                                  },
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 8,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 8,
-                                      "column": 18
-                                    }
-                                  }
-                                },
-                                "init": {
-                                  "type": "ETSNewClassInstanceExpression",
-                                  "typeReference": {
-                                    "type": "ETSTypeReference",
-                                    "part": {
-                                      "type": "ETSTypeReferencePart",
-                                      "name": {
-                                        "type": "Identifier",
-                                        "name": "A",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 8,
-                                            "column": 28
-                                          },
-                                          "end": {
-                                            "line": 8,
-                                            "column": 29
-                                          }
-                                        }
-                                      },
-                                      "loc": {
-                                        "start": {
-                                          "line": 8,
-                                          "column": 28
-                                        },
-                                        "end": {
-                                          "line": 8,
-                                          "column": 30
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 8,
-                                        "column": 28
-                                      },
-                                      "end": {
-                                        "line": 8,
-                                        "column": 30
-                                      }
-                                    }
-                                  },
-                                  "arguments": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 8,
-                                      "column": 24
-                                    },
-                                    "end": {
-                                      "line": 8,
-                                      "column": 32
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 8,
-                                    "column": 17
-                                  },
-                                  "end": {
-                                    "line": 8,
-                                    "column": 32
-                                  }
-                                }
-                              }
-                            ],
-                            "kind": "let",
-                            "loc": {
-                              "start": {
-                                "line": 8,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 8,
-                                "column": 32
-                              }
-                            }
-                          },
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "AssignmentExpression",
-                              "operator": "=",
-                              "left": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "Identifier",
-                                  "name": "a",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 9,
-                                      "column": 13
-                                    },
-                                    "end": {
-                                      "line": 9,
-                                      "column": 14
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "a",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 9,
-                                      "column": 15
-                                    },
-                                    "end": {
-                                      "line": 9,
-                                      "column": 16
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 9,
-                                    "column": 13
-                                  },
-                                  "end": {
-                                    "line": 9,
-                                    "column": 16
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "NumberLiteral",
-                                "value": 13,
-                                "loc": {
-                                  "start": {
-                                    "line": 9,
-                                    "column": 19
-                                  },
-                                  "end": {
-                                    "line": 9,
-                                    "column": 21
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 9,
-                                  "column": 13
-                                },
-                                "end": {
-                                  "line": 9,
-                                  "column": 21
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 9,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 9,
-                                "column": 22
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 7,
-                            "column": 21
-                          },
-                          "end": {
-                            "line": 10,
-                            "column": 10
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 7,
-                          "column": 12
-                        },
-                        "end": {
-                          "line": 10,
-                          "column": 10
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 7,
-                        "column": 12
-                      },
-                      "end": {
-                        "line": 10,
-                        "column": 10
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 7,
-                      "column": 9
-                    },
-                    "end": {
-                      "line": 10,
-                      "column": 10
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 11,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 11,
-                      "column": 6
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 6,
-                  "column": 13
-                },
-                "end": {
-                  "line": 11,
-                  "column": 6
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 6,
-                "column": 5
-              },
-              "end": {
-                "line": 11,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 12,
-                "column": 2
-              },
-              "end": {
-                "line": 12,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 13
-          },
-          "end": {
-            "line": 12,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 12,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "C",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 15,
-              "column": 7
-            },
-            "end": {
-              "line": 15,
-              "column": 8
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "c",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 16,
-                  "column": 13
-                },
-                "end": {
-                  "line": 16,
-                  "column": 14
-                }
-              }
-            },
-            "value": {
-              "type": "NumberLiteral",
-              "value": 12,
-              "loc": {
-                "start": {
-                  "line": 16,
-                  "column": 22
-                },
-                "end": {
-                  "line": 16,
-                  "column": 24
-                }
-              }
-            },
-            "accessibility": "private",
-            "static": false,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSPrimitiveType",
-              "loc": {
-                "start": {
-                  "line": 16,
-                  "column": 16
-                },
-                "end": {
-                  "line": 16,
-                  "column": 19
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 17,
-                "column": 2
-              },
-              "end": {
-                "line": 17,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 15,
-            "column": 9
-          },
-          "end": {
-            "line": 17,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 15,
-          "column": 1
-        },
-        "end": {
-          "line": 17,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "D",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 19,
-              "column": 7
-            },
-            "end": {
-              "line": 19,
-              "column": 8
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "foo",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 20,
-                  "column": 5
-                },
-                "end": {
-                  "line": 20,
-                  "column": 8
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "foo",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 20,
-                      "column": 5
-                    },
-                    "end": {
-                      "line": 20,
-                      "column": 8
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 20,
-                      "column": 12
-                    },
-                    "end": {
-                      "line": 20,
-                      "column": 16
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [
-                    {
-                      "type": "VariableDeclaration",
-                      "declarations": [
-                        {
-                          "type": "VariableDeclarator",
-                          "id": {
-                            "type": "Identifier",
-                            "name": "c",
-                            "typeAnnotation": {
-                              "type": "ETSTypeReference",
-                              "part": {
-                                "type": "ETSTypeReferencePart",
-                                "name": {
-                                  "type": "Identifier",
-                                  "name": "C",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 21,
-                                      "column": 16
-                                    },
-                                    "end": {
-                                      "line": 21,
-                                      "column": 17
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 21,
-                                    "column": 16
-                                  },
-                                  "end": {
-                                    "line": 21,
-                                    "column": 19
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 21,
-                                  "column": 16
-                                },
-                                "end": {
-                                  "line": 21,
-                                  "column": 19
-                                }
-                              }
-                            },
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 21,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 21,
-                                "column": 14
-                              }
-                            }
-                          },
-                          "init": {
-                            "type": "ETSNewClassInstanceExpression",
-                            "typeReference": {
-                              "type": "ETSTypeReference",
-                              "part": {
-                                "type": "ETSTypeReferencePart",
-                                "name": {
-                                  "type": "Identifier",
-                                  "name": "C",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 21,
-                                      "column": 24
-                                    },
-                                    "end": {
-                                      "line": 21,
-                                      "column": 25
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 21,
-                                    "column": 24
-                                  },
-                                  "end": {
-                                    "line": 21,
-                                    "column": 26
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 21,
-                                  "column": 24
-                                },
-                                "end": {
-                                  "line": 21,
-                                  "column": 26
-                                }
-                              }
-                            },
-                            "arguments": [],
-                            "loc": {
-                              "start": {
-                                "line": 21,
-                                "column": 20
-                              },
-                              "end": {
-                                "line": 21,
-                                "column": 28
-                              }
-                            }
-                          },
-                          "loc": {
-                            "start": {
-                              "line": 21,
-                              "column": 13
-                            },
-                            "end": {
-                              "line": 21,
-                              "column": 28
-                            }
-                          }
-                        }
-                      ],
-                      "kind": "let",
-                      "loc": {
-                        "start": {
-                          "line": 21,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 21,
-                          "column": 28
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "AssignmentExpression",
-                        "operator": "=",
-                        "left": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "c",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 22,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 22,
-                                "column": 10
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "c",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 22,
-                                "column": 11
-                              },
-                              "end": {
-                                "line": 22,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 22,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 22,
-                              "column": 12
-                            }
-                          }
-                        },
-                        "right": {
-                          "type": "NumberLiteral",
-                          "value": 13,
-                          "loc": {
-                            "start": {
-                              "line": 22,
-                              "column": 15
-                            },
-                            "end": {
-                              "line": 22,
-                              "column": 17
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 22,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 22,
-                            "column": 17
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 22,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 22,
-                          "column": 18
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 20,
-                      "column": 17
-                    },
-                    "end": {
-                      "line": 23,
-                      "column": 6
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 20,
-                    "column": 8
-                  },
-                  "end": {
-                    "line": 23,
-                    "column": 6
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 20,
-                  "column": 8
-                },
-                "end": {
-                  "line": 23,
-                  "column": 6
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 20,
-                "column": 5
-              },
-              "end": {
-                "line": 23,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 24,
-                "column": 2
-              },
-              "end": {
-                "line": 24,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 19,
-            "column": 9
-          },
-          "end": {
-            "line": 24,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 19,
-          "column": 1
-        },
-        "end": {
-          "line": 24,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 25,
-      "column": 1
-    }
-  }
-}
-TypeError: Property c is not visible here. [invalidPrivateAccess6.ets:22:11]
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [invalidPrivateAccess6.ets:17:5]
diff --git a/ets2panda/test/compiler/ets/override13-expected.txt b/ets2panda/test/compiler/ets/override13-expected.txt
index 6d19ccb713..36b7fc2bb3 100644
--- a/ets2panda/test/compiler/ets/override13-expected.txt
+++ b/ets2panda/test/compiler/ets/override13-expected.txt
@@ -1618,4 +1618,4 @@
     }
   }
 }
-TypeError: fn2<Object>(t: Object): String in B cannot override fn2<T>(t: T): T in A because overriding return type is not compatible with the other return type. [override13.ets:25:15]
+TypeError: Cannot access property of non-object or non-enum type [override13.ets:25:52]
diff --git a/ets2panda/test/compiler/ets/staticInitializerInInnerClass-expected.txt b/ets2panda/test/compiler/ets/staticInitializerInInnerClass-expected.txt
index 5834ed9c38..f5c2bf1123 100644
--- a/ets2panda/test/compiler/ets/staticInitializerInInnerClass-expected.txt
+++ b/ets2panda/test/compiler/ets/staticInitializerInInnerClass-expected.txt
@@ -1,686 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "Outer",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 2,
-              "column": 7
-            },
-            "end": {
-              "line": 2,
-              "column": 12
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "Inner",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 3,
-                    "column": 11
-                  },
-                  "end": {
-                    "line": 3,
-                    "column": 16
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "ClassStaticBlock",
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "<cctor>",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": true,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 6,
-                      "column": 9
-                    },
-                    "end": {
-                      "line": 6,
-                      "column": 10
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 7,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 7,
-                      "column": 6
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 3,
-                  "column": 17
-                },
-                "end": {
-                  "line": 7,
-                  "column": 6
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 3,
-                "column": 5
-              },
-              "end": {
-                "line": 7,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "Inner2",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 9,
-                    "column": 18
-                  },
-                  "end": {
-                    "line": 9,
-                    "column": 24
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "ClassStaticBlock",
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "<cctor>",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": true,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 12,
-                      "column": 9
-                    },
-                    "end": {
-                      "line": 12,
-                      "column": 10
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 13,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 13,
-                      "column": 6
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 9,
-                  "column": 25
-                },
-                "end": {
-                  "line": 13,
-                  "column": 6
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 9,
-                "column": 12
-              },
-              "end": {
-                "line": 13,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "ClassStaticBlock",
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "<cctor>",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": true,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 17,
-                "column": 5
-              },
-              "end": {
-                "line": 17,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 18,
-                "column": 2
-              },
-              "end": {
-                "line": 18,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 2,
-            "column": 13
-          },
-          "end": {
-            "line": 18,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 2,
-          "column": 1
-        },
-        "end": {
-          "line": 18,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 19,
-      "column": 1
-    }
-  }
-}
-TypeError: Static initializer is not allowed in inner class. [staticInitializerInInnerClass.ets:6:9]
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [staticInitializerInInnerClass.ets:17:5]
diff --git a/ets2panda/test/parser/ets/StringFasta-expected.txt b/ets2panda/test/parser/ets/StringFasta-expected.txt
index da90de55e7..0c8c91c32c 100644
--- a/ets2panda/test/parser/ets/StringFasta-expected.txt
+++ b/ets2panda/test/parser/ets/StringFasta-expected.txt
@@ -1,9690 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "StringFasta",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 16,
-              "column": 19
-            },
-            "end": {
-              "line": 16,
-              "column": 30
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "ALU",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 17,
-                  "column": 21
-                },
-                "end": {
-                  "line": 17,
-                  "column": 24
-                }
-              }
-            },
-            "value": {
-              "type": "BinaryExpression",
-              "operator": "+",
-              "left": {
-                "type": "BinaryExpression",
-                "operator": "+",
-                "left": {
-                  "type": "BinaryExpression",
-                  "operator": "+",
-                  "left": {
-                    "type": "BinaryExpression",
-                    "operator": "+",
-                    "left": {
-                      "type": "BinaryExpression",
-                      "operator": "+",
-                      "left": {
-                        "type": "BinaryExpression",
-                        "operator": "+",
-                        "left": {
-                          "type": "StringLiteral",
-                          "value": "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG",
-                          "loc": {
-                            "start": {
-                              "line": 17,
-                              "column": 36
-                            },
-                            "end": {
-                              "line": 17,
-                              "column": 80
-                            }
-                          }
-                        },
-                        "right": {
-                          "type": "StringLiteral",
-                          "value": "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA",
-                          "loc": {
-                            "start": {
-                              "line": 17,
-                              "column": 83
-                            },
-                            "end": {
-                              "line": 17,
-                              "column": 127
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 17,
-                            "column": 36
-                          },
-                          "end": {
-                            "line": 17,
-                            "column": 127
-                          }
-                        }
-                      },
-                      "right": {
-                        "type": "StringLiteral",
-                        "value": "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT",
-                        "loc": {
-                          "start": {
-                            "line": 17,
-                            "column": 130
-                          },
-                          "end": {
-                            "line": 17,
-                            "column": 174
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 17,
-                          "column": 36
-                        },
-                        "end": {
-                          "line": 17,
-                          "column": 174
-                        }
-                      }
-                    },
-                    "right": {
-                      "type": "StringLiteral",
-                      "value": "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA",
-                      "loc": {
-                        "start": {
-                          "line": 17,
-                          "column": 177
-                        },
-                        "end": {
-                          "line": 17,
-                          "column": 221
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 17,
-                        "column": 36
-                      },
-                      "end": {
-                        "line": 17,
-                        "column": 221
-                      }
-                    }
-                  },
-                  "right": {
-                    "type": "StringLiteral",
-                    "value": "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG",
-                    "loc": {
-                      "start": {
-                        "line": 17,
-                        "column": 224
-                      },
-                      "end": {
-                        "line": 17,
-                        "column": 268
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 17,
-                      "column": 36
-                    },
-                    "end": {
-                      "line": 17,
-                      "column": 268
-                    }
-                  }
-                },
-                "right": {
-                  "type": "StringLiteral",
-                  "value": "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC",
-                  "loc": {
-                    "start": {
-                      "line": 17,
-                      "column": 271
-                    },
-                    "end": {
-                      "line": 17,
-                      "column": 315
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 17,
-                    "column": 36
-                  },
-                  "end": {
-                    "line": 17,
-                    "column": 315
-                  }
-                }
-              },
-              "right": {
-                "type": "StringLiteral",
-                "value": "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA",
-                "loc": {
-                  "start": {
-                    "line": 17,
-                    "column": 318
-                  },
-                  "end": {
-                    "line": 17,
-                    "column": 355
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 17,
-                  "column": 36
-                },
-                "end": {
-                  "line": 17,
-                  "column": 355
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": true,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSTypeReference",
-              "part": {
-                "type": "ETSTypeReferencePart",
-                "name": {
-                  "type": "Identifier",
-                  "name": "String",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 17,
-                      "column": 27
-                    },
-                    "end": {
-                      "line": 17,
-                      "column": 33
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 17,
-                    "column": 27
-                  },
-                  "end": {
-                    "line": 17,
-                    "column": 35
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 17,
-                  "column": 27
-                },
-                "end": {
-                  "line": 17,
-                  "column": 35
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "IUB",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 18,
-                  "column": 12
-                },
-                "end": {
-                  "line": 18,
-                  "column": 15
-                }
-              }
-            },
-            "value": {
-              "type": "ETSNewClassInstanceExpression",
-              "typeReference": {
-                "type": "ETSTypeReference",
-                "part": {
-                  "type": "ETSTypeReferencePart",
-                  "name": {
-                    "type": "Identifier",
-                    "name": "HashMap",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 18,
-                        "column": 46
-                      },
-                      "end": {
-                        "line": 18,
-                        "column": 53
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 18,
-                      "column": 46
-                    },
-                    "end": {
-                      "line": 18,
-                      "column": 54
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 18,
-                    "column": 46
-                  },
-                  "end": {
-                    "line": 18,
-                    "column": 54
-                  }
-                }
-              },
-              "arguments": [],
-              "loc": {
-                "start": {
-                  "line": 18,
-                  "column": 42
-                },
-                "end": {
-                  "line": 18,
-                  "column": 56
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": true,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSTypeReference",
-              "part": {
-                "type": "ETSTypeReferencePart",
-                "name": {
-                  "type": "Identifier",
-                  "name": "HashMap",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 18,
-                      "column": 18
-                    },
-                    "end": {
-                      "line": 18,
-                      "column": 25
-                    }
-                  }
-                },
-                "typeParams": {
-                  "type": "TSTypeParameterInstantiation",
-                  "params": [
-                    {
-                      "type": "ETSTypeReference",
-                      "part": {
-                        "type": "ETSTypeReferencePart",
-                        "name": {
-                          "type": "Identifier",
-                          "name": "Char",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 18,
-                              "column": 26
-                            },
-                            "end": {
-                              "line": 18,
-                              "column": 30
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 18,
-                            "column": 26
-                          },
-                          "end": {
-                            "line": 18,
-                            "column": 31
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 18,
-                          "column": 26
-                        },
-                        "end": {
-                          "line": 18,
-                          "column": 31
-                        }
-                      }
-                    },
-                    {
-                      "type": "ETSTypeReference",
-                      "part": {
-                        "type": "ETSTypeReferencePart",
-                        "name": {
-                          "type": "Identifier",
-                          "name": "Double",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 18,
-                              "column": 32
-                            },
-                            "end": {
-                              "line": 18,
-                              "column": 38
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 18,
-                            "column": 32
-                          },
-                          "end": {
-                            "line": 18,
-                            "column": 39
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 18,
-                          "column": 32
-                        },
-                        "end": {
-                          "line": 18,
-                          "column": 39
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 18,
-                      "column": 25
-                    },
-                    "end": {
-                      "line": 18,
-                      "column": 39
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 18,
-                    "column": 18
-                  },
-                  "end": {
-                    "line": 18,
-                    "column": 41
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 18,
-                  "column": 18
-                },
-                "end": {
-                  "line": 18,
-                  "column": 41
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "HomoSap",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 19,
-                  "column": 12
-                },
-                "end": {
-                  "line": 19,
-                  "column": 19
-                }
-              }
-            },
-            "value": {
-              "type": "ETSNewClassInstanceExpression",
-              "typeReference": {
-                "type": "ETSTypeReference",
-                "part": {
-                  "type": "ETSTypeReferencePart",
-                  "name": {
-                    "type": "Identifier",
-                    "name": "HashMap",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 19,
-                        "column": 50
-                      },
-                      "end": {
-                        "line": 19,
-                        "column": 57
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 19,
-                      "column": 50
-                    },
-                    "end": {
-                      "line": 19,
-                      "column": 58
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 19,
-                    "column": 50
-                  },
-                  "end": {
-                    "line": 19,
-                    "column": 58
-                  }
-                }
-              },
-              "arguments": [],
-              "loc": {
-                "start": {
-                  "line": 19,
-                  "column": 46
-                },
-                "end": {
-                  "line": 19,
-                  "column": 60
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": true,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSTypeReference",
-              "part": {
-                "type": "ETSTypeReferencePart",
-                "name": {
-                  "type": "Identifier",
-                  "name": "HashMap",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 19,
-                      "column": 22
-                    },
-                    "end": {
-                      "line": 19,
-                      "column": 29
-                    }
-                  }
-                },
-                "typeParams": {
-                  "type": "TSTypeParameterInstantiation",
-                  "params": [
-                    {
-                      "type": "ETSTypeReference",
-                      "part": {
-                        "type": "ETSTypeReferencePart",
-                        "name": {
-                          "type": "Identifier",
-                          "name": "Char",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 19,
-                              "column": 30
-                            },
-                            "end": {
-                              "line": 19,
-                              "column": 34
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 19,
-                            "column": 30
-                          },
-                          "end": {
-                            "line": 19,
-                            "column": 35
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 19,
-                          "column": 30
-                        },
-                        "end": {
-                          "line": 19,
-                          "column": 35
-                        }
-                      }
-                    },
-                    {
-                      "type": "ETSTypeReference",
-                      "part": {
-                        "type": "ETSTypeReferencePart",
-                        "name": {
-                          "type": "Identifier",
-                          "name": "Double",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 19,
-                              "column": 36
-                            },
-                            "end": {
-                              "line": 19,
-                              "column": 42
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 19,
-                            "column": 36
-                          },
-                          "end": {
-                            "line": 19,
-                            "column": 43
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 19,
-                          "column": 36
-                        },
-                        "end": {
-                          "line": 19,
-                          "column": 43
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 19,
-                      "column": 29
-                    },
-                    "end": {
-                      "line": 19,
-                      "column": 43
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 19,
-                    "column": 22
-                  },
-                  "end": {
-                    "line": 19,
-                    "column": 45
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 19,
-                  "column": 22
-                },
-                "end": {
-                  "line": 19,
-                  "column": 45
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "ClassStaticBlock",
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "<cctor>",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": true,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 21,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 21,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 21,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 21,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 21,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 21,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "a",
-                            "loc": {
-                              "start": {
-                                "line": 21,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 21,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 21,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 21,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 21,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 21,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 21,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 21,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 22,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 22,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 22,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 22,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 22,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 22,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "c",
-                            "loc": {
-                              "start": {
-                                "line": 22,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 22,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 22,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 22,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 22,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 22,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 22,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 22,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 23,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 23,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 23,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 23,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 23,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 23,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "g",
-                            "loc": {
-                              "start": {
-                                "line": 23,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 23,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 23,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 23,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 23,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 23,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 23,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 23,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 24,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 24,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 24,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 24,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 24,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 24,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "t",
-                            "loc": {
-                              "start": {
-                                "line": 24,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 24,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 24,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 24,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 24,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 24,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 24,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 24,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 25,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 25,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 25,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 25,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 25,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 25,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "B",
-                            "loc": {
-                              "start": {
-                                "line": 25,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 25,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 25,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 25,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 25,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 25,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 25,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 25,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 26,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 26,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 26,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 26,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 26,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 26,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "D",
-                            "loc": {
-                              "start": {
-                                "line": 26,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 26,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 26,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 26,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 26,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 26,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 26,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 26,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 27,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 27,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 27,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 27,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 27,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 27,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "H",
-                            "loc": {
-                              "start": {
-                                "line": 27,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 27,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 27,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 27,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 27,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 27,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 27,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 27,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 28,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 28,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 28,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 28,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 28,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 28,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "K",
-                            "loc": {
-                              "start": {
-                                "line": 28,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 28,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 28,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 28,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 28,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 28,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 28,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 28,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 29,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 29,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 29,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 29,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 29,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 29,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "M",
-                            "loc": {
-                              "start": {
-                                "line": 29,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 29,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 29,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 29,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 29,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 29,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 29,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 29,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 30,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 30,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 30,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 30,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 30,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 30,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "N",
-                            "loc": {
-                              "start": {
-                                "line": 30,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 30,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 30,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 30,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 30,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 30,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 30,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 30,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 31,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 31,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 31,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 31,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 31,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 31,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "R",
-                            "loc": {
-                              "start": {
-                                "line": 31,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 31,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 31,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 31,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 31,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 31,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 31,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 31,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 32,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 32,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 32,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 32,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 32,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 32,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "S",
-                            "loc": {
-                              "start": {
-                                "line": 32,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 32,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 32,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 32,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 32,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 32,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 32,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 32,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 33,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 33,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 33,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 33,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 33,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 33,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "V",
-                            "loc": {
-                              "start": {
-                                "line": 33,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 33,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 33,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 33,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 33,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 33,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 33,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 33,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 34,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 34,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 34,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 34,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 34,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 34,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "W",
-                            "loc": {
-                              "start": {
-                                "line": 34,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 34,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 34,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 34,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 34,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 34,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 34,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 34,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "IUB",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 35,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 35,
-                                "column": 12
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 35,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 35,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 35,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 35,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "Y",
-                            "loc": {
-                              "start": {
-                                "line": 35,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 35,
-                                "column": 20
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.2,
-                            "loc": {
-                              "start": {
-                                "line": 35,
-                                "column": 22
-                              },
-                              "end": {
-                                "line": 35,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 35,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 35,
-                            "column": 26
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 35,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 35,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "HomoSap",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 36,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 36,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 36,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 36,
-                                "column": 20
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 36,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 36,
-                              "column": 20
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "a",
-                            "loc": {
-                              "start": {
-                                "line": 36,
-                                "column": 21
-                              },
-                              "end": {
-                                "line": 36,
-                                "column": 24
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.302955,
-                            "loc": {
-                              "start": {
-                                "line": 36,
-                                "column": 26
-                              },
-                              "end": {
-                                "line": 36,
-                                "column": 41
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 36,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 36,
-                            "column": 42
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 36,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 36,
-                          "column": 43
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "HomoSap",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 37,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 37,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 37,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 37,
-                                "column": 20
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 37,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 37,
-                              "column": 20
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "c",
-                            "loc": {
-                              "start": {
-                                "line": 37,
-                                "column": 21
-                              },
-                              "end": {
-                                "line": 37,
-                                "column": 24
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.197988,
-                            "loc": {
-                              "start": {
-                                "line": 37,
-                                "column": 26
-                              },
-                              "end": {
-                                "line": 37,
-                                "column": 41
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 37,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 37,
-                            "column": 42
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 37,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 37,
-                          "column": 43
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "HomoSap",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 38,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 38,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 38,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 38,
-                                "column": 20
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 38,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 38,
-                              "column": 20
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "g",
-                            "loc": {
-                              "start": {
-                                "line": 38,
-                                "column": 21
-                              },
-                              "end": {
-                                "line": 38,
-                                "column": 24
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.197547,
-                            "loc": {
-                              "start": {
-                                "line": 38,
-                                "column": 26
-                              },
-                              "end": {
-                                "line": 38,
-                                "column": 41
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 38,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 38,
-                            "column": 42
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 38,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 38,
-                          "column": 43
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "HomoSap",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 39,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 39,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "put",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 39,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 39,
-                                "column": 20
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 39,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 39,
-                              "column": 20
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "CharLiteral",
-                            "value": "t",
-                            "loc": {
-                              "start": {
-                                "line": 39,
-                                "column": 21
-                              },
-                              "end": {
-                                "line": 39,
-                                "column": 24
-                              }
-                            }
-                          },
-                          {
-                            "type": "NumberLiteral",
-                            "value": 0.301509,
-                            "loc": {
-                              "start": {
-                                "line": 39,
-                                "column": 26
-                              },
-                              "end": {
-                                "line": 39,
-                                "column": 41
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 39,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 39,
-                            "column": 42
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 39,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 39,
-                          "column": 43
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 40,
-                "column": 5
-              },
-              "end": {
-                "line": 40,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "Random",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 41,
-                    "column": 23
-                  },
-                  "end": {
-                    "line": 41,
-                    "column": 29
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "ClassProperty",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "last",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 42,
-                        "column": 16
-                      },
-                      "end": {
-                        "line": 42,
-                        "column": 20
-                      }
-                    }
-                  },
-                  "value": {
-                    "type": "NumberLiteral",
-                    "value": 42,
-                    "loc": {
-                      "start": {
-                        "line": 42,
-                        "column": 29
-                      },
-                      "end": {
-                        "line": 42,
-                        "column": 31
-                      }
-                    }
-                  },
-                  "accessibility": "public",
-                  "static": true,
-                  "readonly": false,
-                  "declare": false,
-                  "optional": false,
-                  "computed": false,
-                  "typeAnnotation": {
-                    "type": "ETSPrimitiveType",
-                    "loc": {
-                      "start": {
-                        "line": 42,
-                        "column": 23
-                      },
-                      "end": {
-                        "line": 42,
-                        "column": 26
-                      }
-                    }
-                  },
-                  "definite": false,
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                {
-                  "type": "ClassProperty",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "A",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 43,
-                        "column": 16
-                      },
-                      "end": {
-                        "line": 43,
-                        "column": 17
-                      }
-                    }
-                  },
-                  "value": {
-                    "type": "NumberLiteral",
-                    "value": 3877,
-                    "loc": {
-                      "start": {
-                        "line": 43,
-                        "column": 26
-                      },
-                      "end": {
-                        "line": 43,
-                        "column": 30
-                      }
-                    }
-                  },
-                  "accessibility": "public",
-                  "static": true,
-                  "readonly": false,
-                  "declare": false,
-                  "optional": false,
-                  "computed": false,
-                  "typeAnnotation": {
-                    "type": "ETSPrimitiveType",
-                    "loc": {
-                      "start": {
-                        "line": 43,
-                        "column": 20
-                      },
-                      "end": {
-                        "line": 43,
-                        "column": 23
-                      }
-                    }
-                  },
-                  "definite": false,
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                {
-                  "type": "ClassProperty",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "C",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 44,
-                        "column": 16
-                      },
-                      "end": {
-                        "line": 44,
-                        "column": 17
-                      }
-                    }
-                  },
-                  "value": {
-                    "type": "NumberLiteral",
-                    "value": 29573,
-                    "loc": {
-                      "start": {
-                        "line": 44,
-                        "column": 26
-                      },
-                      "end": {
-                        "line": 44,
-                        "column": 31
-                      }
-                    }
-                  },
-                  "accessibility": "public",
-                  "static": true,
-                  "readonly": false,
-                  "declare": false,
-                  "optional": false,
-                  "computed": false,
-                  "typeAnnotation": {
-                    "type": "ETSPrimitiveType",
-                    "loc": {
-                      "start": {
-                        "line": 44,
-                        "column": 20
-                      },
-                      "end": {
-                        "line": 44,
-                        "column": 23
-                      }
-                    }
-                  },
-                  "definite": false,
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                {
-                  "type": "ClassProperty",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "M",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 45,
-                        "column": 16
-                      },
-                      "end": {
-                        "line": 45,
-                        "column": 17
-                      }
-                    }
-                  },
-                  "value": {
-                    "type": "NumberLiteral",
-                    "value": 139968,
-                    "loc": {
-                      "start": {
-                        "line": 45,
-                        "column": 26
-                      },
-                      "end": {
-                        "line": 45,
-                        "column": 32
-                      }
-                    }
-                  },
-                  "accessibility": "public",
-                  "static": true,
-                  "readonly": false,
-                  "declare": false,
-                  "optional": false,
-                  "computed": false,
-                  "typeAnnotation": {
-                    "type": "ETSPrimitiveType",
-                    "loc": {
-                      "start": {
-                        "line": 45,
-                        "column": 20
-                      },
-                      "end": {
-                        "line": 45,
-                        "column": 23
-                      }
-                    }
-                  },
-                  "definite": false,
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "rand",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 46,
-                        "column": 23
-                      },
-                      "end": {
-                        "line": 46,
-                        "column": 27
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": true,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "rand",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 46,
-                            "column": 23
-                          },
-                          "end": {
-                            "line": 46,
-                            "column": 27
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [
-                        {
-                          "type": "Identifier",
-                          "name": "max",
-                          "typeAnnotation": {
-                            "type": "ETSPrimitiveType",
-                            "loc": {
-                              "start": {
-                                "line": 46,
-                                "column": 34
-                              },
-                              "end": {
-                                "line": 46,
-                                "column": 40
-                              }
-                            }
-                          },
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 46,
-                              "column": 28
-                            },
-                            "end": {
-                              "line": 46,
-                              "column": 40
-                            }
-                          }
-                        }
-                      ],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 46,
-                            "column": 43
-                          },
-                          "end": {
-                            "line": 46,
-                            "column": 49
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "AssignmentExpression",
-                              "operator": "=",
-                              "left": {
-                                "type": "Identifier",
-                                "name": "last",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 47,
-                                    "column": 13
-                                  },
-                                  "end": {
-                                    "line": 47,
-                                    "column": 17
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "BinaryExpression",
-                                "operator": "%",
-                                "left": {
-                                  "type": "BinaryExpression",
-                                  "operator": "+",
-                                  "left": {
-                                    "type": "BinaryExpression",
-                                    "operator": "*",
-                                    "left": {
-                                      "type": "Identifier",
-                                      "name": "last",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 47,
-                                          "column": 21
-                                        },
-                                        "end": {
-                                          "line": 47,
-                                          "column": 25
-                                        }
-                                      }
-                                    },
-                                    "right": {
-                                      "type": "Identifier",
-                                      "name": "A",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 47,
-                                          "column": 28
-                                        },
-                                        "end": {
-                                          "line": 47,
-                                          "column": 29
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 47,
-                                        "column": 21
-                                      },
-                                      "end": {
-                                        "line": 47,
-                                        "column": 29
-                                      }
-                                    }
-                                  },
-                                  "right": {
-                                    "type": "Identifier",
-                                    "name": "C",
-                                    "decorators": [],
-                                    "loc": {
-                                      "start": {
-                                        "line": 47,
-                                        "column": 32
-                                      },
-                                      "end": {
-                                        "line": 47,
-                                        "column": 33
-                                      }
-                                    }
-                                  },
-                                  "loc": {
-                                    "start": {
-                                      "line": 47,
-                                      "column": 20
-                                    },
-                                    "end": {
-                                      "line": 47,
-                                      "column": 34
-                                    }
-                                  }
-                                },
-                                "right": {
-                                  "type": "Identifier",
-                                  "name": "M",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 47,
-                                      "column": 37
-                                    },
-                                    "end": {
-                                      "line": 47,
-                                      "column": 38
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 47,
-                                    "column": 20
-                                  },
-                                  "end": {
-                                    "line": 47,
-                                    "column": 38
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 47,
-                                  "column": 13
-                                },
-                                "end": {
-                                  "line": 47,
-                                  "column": 38
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 47,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 47,
-                                "column": 39
-                              }
-                            }
-                          },
-                          {
-                            "type": "ReturnStatement",
-                            "argument": {
-                              "type": "BinaryExpression",
-                              "operator": "/",
-                              "left": {
-                                "type": "BinaryExpression",
-                                "operator": "*",
-                                "left": {
-                                  "type": "Identifier",
-                                  "name": "max",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 48,
-                                      "column": 20
-                                    },
-                                    "end": {
-                                      "line": 48,
-                                      "column": 23
-                                    }
-                                  }
-                                },
-                                "right": {
-                                  "type": "Identifier",
-                                  "name": "last",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 48,
-                                      "column": 26
-                                    },
-                                    "end": {
-                                      "line": 48,
-                                      "column": 30
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 48,
-                                    "column": 20
-                                  },
-                                  "end": {
-                                    "line": 48,
-                                    "column": 30
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "Identifier",
-                                "name": "M",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 48,
-                                    "column": 33
-                                  },
-                                  "end": {
-                                    "line": 48,
-                                    "column": 34
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 48,
-                                  "column": 20
-                                },
-                                "end": {
-                                  "line": 48,
-                                  "column": 34
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 48,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 48,
-                                "column": 35
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 46,
-                            "column": 50
-                          },
-                          "end": {
-                            "line": 49,
-                            "column": 10
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 46,
-                          "column": 27
-                        },
-                        "end": {
-                          "line": 49,
-                          "column": 10
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 46,
-                        "column": 27
-                      },
-                      "end": {
-                        "line": 49,
-                        "column": 10
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 46,
-                      "column": 9
-                    },
-                    "end": {
-                      "line": 49,
-                      "column": 10
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 50,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 50,
-                      "column": 6
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 41,
-                  "column": 31
-                },
-                "end": {
-                  "line": 50,
-                  "column": 6
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 41,
-                "column": 17
-              },
-              "end": {
-                "line": 50,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "makeCumulative",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 52,
-                  "column": 12
-                },
-                "end": {
-                  "line": 52,
-                  "column": 26
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": true,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "makeCumulative",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 52,
-                      "column": 12
-                    },
-                    "end": {
-                      "line": 52,
-                      "column": 26
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [
-                  {
-                    "type": "Identifier",
-                    "name": "table",
-                    "typeAnnotation": {
-                      "type": "ETSTypeReference",
-                      "part": {
-                        "type": "ETSTypeReferencePart",
-                        "name": {
-                          "type": "Identifier",
-                          "name": "HashMap",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 52,
-                              "column": 35
-                            },
-                            "end": {
-                              "line": 52,
-                              "column": 42
-                            }
-                          }
-                        },
-                        "typeParams": {
-                          "type": "TSTypeParameterInstantiation",
-                          "params": [
-                            {
-                              "type": "ETSTypeReference",
-                              "part": {
-                                "type": "ETSTypeReferencePart",
-                                "name": {
-                                  "type": "Identifier",
-                                  "name": "Char",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 52,
-                                      "column": 43
-                                    },
-                                    "end": {
-                                      "line": 52,
-                                      "column": 47
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 52,
-                                    "column": 43
-                                  },
-                                  "end": {
-                                    "line": 52,
-                                    "column": 48
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 52,
-                                  "column": 43
-                                },
-                                "end": {
-                                  "line": 52,
-                                  "column": 48
-                                }
-                              }
-                            },
-                            {
-                              "type": "ETSTypeReference",
-                              "part": {
-                                "type": "ETSTypeReferencePart",
-                                "name": {
-                                  "type": "Identifier",
-                                  "name": "Double",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 52,
-                                      "column": 49
-                                    },
-                                    "end": {
-                                      "line": 52,
-                                      "column": 55
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 52,
-                                    "column": 49
-                                  },
-                                  "end": {
-                                    "line": 52,
-                                    "column": 56
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 52,
-                                  "column": 49
-                                },
-                                "end": {
-                                  "line": 52,
-                                  "column": 56
-                                }
-                              }
-                            }
-                          ],
-                          "loc": {
-                            "start": {
-                              "line": 52,
-                              "column": 42
-                            },
-                            "end": {
-                              "line": 52,
-                              "column": 56
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 52,
-                            "column": 35
-                          },
-                          "end": {
-                            "line": 52,
-                            "column": 57
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 52,
-                          "column": 35
-                        },
-                        "end": {
-                          "line": 52,
-                          "column": 57
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 52,
-                        "column": 27
-                      },
-                      "end": {
-                        "line": 52,
-                        "column": 57
-                      }
-                    }
-                  }
-                ],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 52,
-                      "column": 59
-                    },
-                    "end": {
-                      "line": 52,
-                      "column": 63
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [
-                    {
-                      "type": "VariableDeclaration",
-                      "declarations": [
-                        {
-                          "type": "VariableDeclarator",
-                          "id": {
-                            "type": "Identifier",
-                            "name": "last",
-                            "typeAnnotation": {
-                              "type": "ETSTypeReference",
-                              "part": {
-                                "type": "ETSTypeReferencePart",
-                                "name": {
-                                  "type": "Identifier",
-                                  "name": "Char",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 53,
-                                      "column": 20
-                                    },
-                                    "end": {
-                                      "line": 53,
-                                      "column": 24
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 53,
-                                    "column": 20
-                                  },
-                                  "end": {
-                                    "line": 53,
-                                    "column": 26
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 53,
-                                  "column": 20
-                                },
-                                "end": {
-                                  "line": 53,
-                                  "column": 26
-                                }
-                              }
-                            },
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 53,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 53,
-                                "column": 17
-                              }
-                            }
-                          },
-                          "init": {
-                            "type": "NullLiteral",
-                            "value": null,
-                            "loc": {
-                              "start": {
-                                "line": 53,
-                                "column": 27
-                              },
-                              "end": {
-                                "line": 53,
-                                "column": 31
-                              }
-                            }
-                          },
-                          "loc": {
-                            "start": {
-                              "line": 53,
-                              "column": 13
-                            },
-                            "end": {
-                              "line": 53,
-                              "column": 31
-                            }
-                          }
-                        }
-                      ],
-                      "kind": "let",
-                      "loc": {
-                        "start": {
-                          "line": 53,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 53,
-                          "column": 32
-                        }
-                      }
-                    },
-                    {
-                      "type": "ForOfStatement",
-                      "await": false,
-                      "left": {
-                        "type": "VariableDeclaration",
-                        "declarations": [
-                          {
-                            "type": "VariableDeclarator",
-                            "id": {
-                              "type": "Identifier",
-                              "name": "entry",
-                              "typeAnnotation": {
-                                "type": "ETSTypeReference",
-                                "part": {
-                                  "type": "ETSTypeReferencePart",
-                                  "name": {
-                                    "type": "TSQualifiedName",
-                                    "left": {
-                                      "type": "Identifier",
-                                      "name": "HashMap",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 54,
-                                          "column": 26
-                                        },
-                                        "end": {
-                                          "line": 54,
-                                          "column": 33
-                                        }
-                                      }
-                                    },
-                                    "right": {
-                                      "type": "Identifier",
-                                      "name": "Entry",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 54,
-                                          "column": 34
-                                        },
-                                        "end": {
-                                          "line": 54,
-                                          "column": 39
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 54,
-                                        "column": 26
-                                      },
-                                      "end": {
-                                        "line": 54,
-                                        "column": 40
-                                      }
-                                    }
-                                  },
-                                  "typeParams": {
-                                    "type": "TSTypeParameterInstantiation",
-                                    "params": [
-                                      {
-                                        "type": "ETSTypeReference",
-                                        "part": {
-                                          "type": "ETSTypeReferencePart",
-                                          "name": {
-                                            "type": "Identifier",
-                                            "name": "Char",
-                                            "decorators": [],
-                                            "loc": {
-                                              "start": {
-                                                "line": 54,
-                                                "column": 40
-                                              },
-                                              "end": {
-                                                "line": 54,
-                                                "column": 44
-                                              }
-                                            }
-                                          },
-                                          "loc": {
-                                            "start": {
-                                              "line": 54,
-                                              "column": 40
-                                            },
-                                            "end": {
-                                              "line": 54,
-                                              "column": 45
-                                            }
-                                          }
-                                        },
-                                        "loc": {
-                                          "start": {
-                                            "line": 54,
-                                            "column": 40
-                                          },
-                                          "end": {
-                                            "line": 54,
-                                            "column": 45
-                                          }
-                                        }
-                                      },
-                                      {
-                                        "type": "ETSTypeReference",
-                                        "part": {
-                                          "type": "ETSTypeReferencePart",
-                                          "name": {
-                                            "type": "Identifier",
-                                            "name": "Double",
-                                            "decorators": [],
-                                            "loc": {
-                                              "start": {
-                                                "line": 54,
-                                                "column": 46
-                                              },
-                                              "end": {
-                                                "line": 54,
-                                                "column": 52
-                                              }
-                                            }
-                                          },
-                                          "loc": {
-                                            "start": {
-                                              "line": 54,
-                                              "column": 46
-                                            },
-                                            "end": {
-                                              "line": 54,
-                                              "column": 53
-                                            }
-                                          }
-                                        },
-                                        "loc": {
-                                          "start": {
-                                            "line": 54,
-                                            "column": 46
-                                          },
-                                          "end": {
-                                            "line": 54,
-                                            "column": 53
-                                          }
-                                        }
-                                      }
-                                    ],
-                                    "loc": {
-                                      "start": {
-                                        "line": 54,
-                                        "column": 39
-                                      },
-                                      "end": {
-                                        "line": 54,
-                                        "column": 53
-                                      }
-                                    }
-                                  },
-                                  "loc": {
-                                    "start": {
-                                      "line": 54,
-                                      "column": 26
-                                    },
-                                    "end": {
-                                      "line": 54,
-                                      "column": 56
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 54,
-                                    "column": 26
-                                  },
-                                  "end": {
-                                    "line": 54,
-                                    "column": 56
-                                  }
-                                }
-                              },
-                              "decorators": [],
-                              "loc": {
-                                "start": {
-                                  "line": 54,
-                                  "column": 18
-                                },
-                                "end": {
-                                  "line": 54,
-                                  "column": 23
-                                }
-                              }
-                            },
-                            "init": null,
-                            "loc": {
-                              "start": {
-                                "line": 54,
-                                "column": 18
-                              },
-                              "end": {
-                                "line": 54,
-                                "column": 23
-                              }
-                            }
-                          }
-                        ],
-                        "kind": "let",
-                        "loc": {
-                          "start": {
-                            "line": 54,
-                            "column": 14
-                          },
-                          "end": {
-                            "line": 54,
-                            "column": 23
-                          }
-                        }
-                      },
-                      "right": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "table",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 54,
-                                "column": 57
-                              },
-                              "end": {
-                                "line": 54,
-                                "column": 62
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "entrySet",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 54,
-                                "column": 63
-                              },
-                              "end": {
-                                "line": 54,
-                                "column": 71
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 54,
-                              "column": 57
-                            },
-                            "end": {
-                              "line": 54,
-                              "column": 71
-                            }
-                          }
-                        },
-                        "arguments": [],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 54,
-                            "column": 57
-                          },
-                          "end": {
-                            "line": 54,
-                            "column": 73
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "VariableDeclaration",
-                            "declarations": [
-                              {
-                                "type": "VariableDeclarator",
-                                "id": {
-                                  "type": "Identifier",
-                                  "name": "c",
-                                  "typeAnnotation": {
-                                    "type": "ETSTypeReference",
-                                    "part": {
-                                      "type": "ETSTypeReferencePart",
-                                      "name": {
-                                        "type": "Identifier",
-                                        "name": "Char",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 55,
-                                            "column": 21
-                                          },
-                                          "end": {
-                                            "line": 55,
-                                            "column": 25
-                                          }
-                                        }
-                                      },
-                                      "loc": {
-                                        "start": {
-                                          "line": 55,
-                                          "column": 21
-                                        },
-                                        "end": {
-                                          "line": 55,
-                                          "column": 27
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 55,
-                                        "column": 21
-                                      },
-                                      "end": {
-                                        "line": 55,
-                                        "column": 27
-                                      }
-                                    }
-                                  },
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 55,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 55,
-                                      "column": 18
-                                    }
-                                  }
-                                },
-                                "init": {
-                                  "type": "CallExpression",
-                                  "callee": {
-                                    "type": "MemberExpression",
-                                    "object": {
-                                      "type": "Identifier",
-                                      "name": "entry",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 55,
-                                          "column": 28
-                                        },
-                                        "end": {
-                                          "line": 55,
-                                          "column": 33
-                                        }
-                                      }
-                                    },
-                                    "property": {
-                                      "type": "Identifier",
-                                      "name": "getKey",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 55,
-                                          "column": 34
-                                        },
-                                        "end": {
-                                          "line": 55,
-                                          "column": 40
-                                        }
-                                      }
-                                    },
-                                    "computed": false,
-                                    "optional": false,
-                                    "loc": {
-                                      "start": {
-                                        "line": 55,
-                                        "column": 28
-                                      },
-                                      "end": {
-                                        "line": 55,
-                                        "column": 40
-                                      }
-                                    }
-                                  },
-                                  "arguments": [],
-                                  "optional": false,
-                                  "loc": {
-                                    "start": {
-                                      "line": 55,
-                                      "column": 28
-                                    },
-                                    "end": {
-                                      "line": 55,
-                                      "column": 42
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 55,
-                                    "column": 17
-                                  },
-                                  "end": {
-                                    "line": 55,
-                                    "column": 42
-                                  }
-                                }
-                              }
-                            ],
-                            "kind": "let",
-                            "loc": {
-                              "start": {
-                                "line": 55,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 55,
-                                "column": 43
-                              }
-                            }
-                          },
-                          {
-                            "type": "IfStatement",
-                            "test": {
-                              "type": "BinaryExpression",
-                              "operator": "!=",
-                              "left": {
-                                "type": "Identifier",
-                                "name": "last",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 56,
-                                    "column": 17
-                                  },
-                                  "end": {
-                                    "line": 56,
-                                    "column": 21
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "NullLiteral",
-                                "value": null,
-                                "loc": {
-                                  "start": {
-                                    "line": 56,
-                                    "column": 25
-                                  },
-                                  "end": {
-                                    "line": 56,
-                                    "column": 29
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 56,
-                                  "column": 17
-                                },
-                                "end": {
-                                  "line": 56,
-                                  "column": 29
-                                }
-                              }
-                            },
-                            "consequent": {
-                              "type": "BlockStatement",
-                              "statements": [
-                                {
-                                  "type": "ExpressionStatement",
-                                  "expression": {
-                                    "type": "CallExpression",
-                                    "callee": {
-                                      "type": "MemberExpression",
-                                      "object": {
-                                        "type": "Identifier",
-                                        "name": "table",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 57,
-                                            "column": 17
-                                          },
-                                          "end": {
-                                            "line": 57,
-                                            "column": 22
-                                          }
-                                        }
-                                      },
-                                      "property": {
-                                        "type": "Identifier",
-                                        "name": "put",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 57,
-                                            "column": 23
-                                          },
-                                          "end": {
-                                            "line": 57,
-                                            "column": 26
-                                          }
-                                        }
-                                      },
-                                      "computed": false,
-                                      "optional": false,
-                                      "loc": {
-                                        "start": {
-                                          "line": 57,
-                                          "column": 17
-                                        },
-                                        "end": {
-                                          "line": 57,
-                                          "column": 26
-                                        }
-                                      }
-                                    },
-                                    "arguments": [
-                                      {
-                                        "type": "Identifier",
-                                        "name": "c",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 57,
-                                            "column": 27
-                                          },
-                                          "end": {
-                                            "line": 57,
-                                            "column": 28
-                                          }
-                                        }
-                                      },
-                                      {
-                                        "type": "BinaryExpression",
-                                        "operator": "+",
-                                        "left": {
-                                          "type": "CallExpression",
-                                          "callee": {
-                                            "type": "MemberExpression",
-                                            "object": {
-                                              "type": "Identifier",
-                                              "name": "entry",
-                                              "decorators": [],
-                                              "loc": {
-                                                "start": {
-                                                  "line": 57,
-                                                  "column": 30
-                                                },
-                                                "end": {
-                                                  "line": 57,
-                                                  "column": 35
-                                                }
-                                              }
-                                            },
-                                            "property": {
-                                              "type": "Identifier",
-                                              "name": "getValue",
-                                              "decorators": [],
-                                              "loc": {
-                                                "start": {
-                                                  "line": 57,
-                                                  "column": 36
-                                                },
-                                                "end": {
-                                                  "line": 57,
-                                                  "column": 44
-                                                }
-                                              }
-                                            },
-                                            "computed": false,
-                                            "optional": false,
-                                            "loc": {
-                                              "start": {
-                                                "line": 57,
-                                                "column": 30
-                                              },
-                                              "end": {
-                                                "line": 57,
-                                                "column": 44
-                                              }
-                                            }
-                                          },
-                                          "arguments": [],
-                                          "optional": false,
-                                          "loc": {
-                                            "start": {
-                                              "line": 57,
-                                              "column": 30
-                                            },
-                                            "end": {
-                                              "line": 57,
-                                              "column": 46
-                                            }
-                                          }
-                                        },
-                                        "right": {
-                                          "type": "CallExpression",
-                                          "callee": {
-                                            "type": "MemberExpression",
-                                            "object": {
-                                              "type": "Identifier",
-                                              "name": "table",
-                                              "decorators": [],
-                                              "loc": {
-                                                "start": {
-                                                  "line": 57,
-                                                  "column": 49
-                                                },
-                                                "end": {
-                                                  "line": 57,
-                                                  "column": 54
-                                                }
-                                              }
-                                            },
-                                            "property": {
-                                              "type": "Identifier",
-                                              "name": "get",
-                                              "decorators": [],
-                                              "loc": {
-                                                "start": {
-                                                  "line": 57,
-                                                  "column": 55
-                                                },
-                                                "end": {
-                                                  "line": 57,
-                                                  "column": 58
-                                                }
-                                              }
-                                            },
-                                            "computed": false,
-                                            "optional": false,
-                                            "loc": {
-                                              "start": {
-                                                "line": 57,
-                                                "column": 49
-                                              },
-                                              "end": {
-                                                "line": 57,
-                                                "column": 58
-                                              }
-                                            }
-                                          },
-                                          "arguments": [
-                                            {
-                                              "type": "Identifier",
-                                              "name": "last",
-                                              "decorators": [],
-                                              "loc": {
-                                                "start": {
-                                                  "line": 57,
-                                                  "column": 59
-                                                },
-                                                "end": {
-                                                  "line": 57,
-                                                  "column": 63
-                                                }
-                                              }
-                                            }
-                                          ],
-                                          "optional": false,
-                                          "loc": {
-                                            "start": {
-                                              "line": 57,
-                                              "column": 49
-                                            },
-                                            "end": {
-                                              "line": 57,
-                                              "column": 64
-                                            }
-                                          }
-                                        },
-                                        "loc": {
-                                          "start": {
-                                            "line": 57,
-                                            "column": 30
-                                          },
-                                          "end": {
-                                            "line": 57,
-                                            "column": 64
-                                          }
-                                        }
-                                      }
-                                    ],
-                                    "optional": false,
-                                    "loc": {
-                                      "start": {
-                                        "line": 57,
-                                        "column": 17
-                                      },
-                                      "end": {
-                                        "line": 57,
-                                        "column": 65
-                                      }
-                                    }
-                                  },
-                                  "loc": {
-                                    "start": {
-                                      "line": 57,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 57,
-                                      "column": 66
-                                    }
-                                  }
-                                }
-                              ],
-                              "loc": {
-                                "start": {
-                                  "line": 56,
-                                  "column": 31
-                                },
-                                "end": {
-                                  "line": 58,
-                                  "column": 14
-                                }
-                              }
-                            },
-                            "alternate": null,
-                            "loc": {
-                              "start": {
-                                "line": 56,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 58,
-                                "column": 14
-                              }
-                            }
-                          },
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "AssignmentExpression",
-                              "operator": "=",
-                              "left": {
-                                "type": "Identifier",
-                                "name": "last",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 59,
-                                    "column": 13
-                                  },
-                                  "end": {
-                                    "line": 59,
-                                    "column": 17
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "Identifier",
-                                "name": "c",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 59,
-                                    "column": 20
-                                  },
-                                  "end": {
-                                    "line": 59,
-                                    "column": 21
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 59,
-                                  "column": 13
-                                },
-                                "end": {
-                                  "line": 59,
-                                  "column": 21
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 59,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 59,
-                                "column": 22
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 54,
-                            "column": 74
-                          },
-                          "end": {
-                            "line": 60,
-                            "column": 10
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 54,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 60,
-                          "column": 10
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 52,
-                      "column": 64
-                    },
-                    "end": {
-                      "line": 61,
-                      "column": 6
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 52,
-                    "column": 26
-                  },
-                  "end": {
-                    "line": 61,
-                    "column": 6
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 52,
-                  "column": 26
-                },
-                "end": {
-                  "line": 61,
-                  "column": 6
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 52,
-                "column": 5
-              },
-              "end": {
-                "line": 61,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "fastaRepeat",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 62,
-                  "column": 12
-                },
-                "end": {
-                  "line": 62,
-                  "column": 23
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": true,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "fastaRepeat",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 62,
-                      "column": 12
-                    },
-                    "end": {
-                      "line": 62,
-                      "column": 23
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [
-                  {
-                    "type": "Identifier",
-                    "name": "n",
-                    "typeAnnotation": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 62,
-                          "column": 28
-                        },
-                        "end": {
-                          "line": 62,
-                          "column": 31
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 62,
-                        "column": 24
-                      },
-                      "end": {
-                        "line": 62,
-                        "column": 31
-                      }
-                    }
-                  },
-                  {
-                    "type": "Identifier",
-                    "name": "seq",
-                    "typeAnnotation": {
-                      "type": "ETSTypeReference",
-                      "part": {
-                        "type": "ETSTypeReferencePart",
-                        "name": {
-                          "type": "Identifier",
-                          "name": "String",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 62,
-                              "column": 39
-                            },
-                            "end": {
-                              "line": 62,
-                              "column": 45
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 62,
-                            "column": 39
-                          },
-                          "end": {
-                            "line": 62,
-                            "column": 46
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 62,
-                          "column": 39
-                        },
-                        "end": {
-                          "line": 62,
-                          "column": 46
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 62,
-                        "column": 33
-                      },
-                      "end": {
-                        "line": 62,
-                        "column": 46
-                      }
-                    }
-                  }
-                ],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 62,
-                      "column": 48
-                    },
-                    "end": {
-                      "line": 62,
-                      "column": 51
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [
-                    {
-                      "type": "VariableDeclaration",
-                      "declarations": [
-                        {
-                          "type": "VariableDeclarator",
-                          "id": {
-                            "type": "Identifier",
-                            "name": "seqi",
-                            "typeAnnotation": {
-                              "type": "ETSPrimitiveType",
-                              "loc": {
-                                "start": {
-                                  "line": 63,
-                                  "column": 20
-                                },
-                                "end": {
-                                  "line": 63,
-                                  "column": 23
-                                }
-                              }
-                            },
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 63,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 63,
-                                "column": 17
-                              }
-                            }
-                          },
-                          "init": {
-                            "type": "NumberLiteral",
-                            "value": 0,
-                            "loc": {
-                              "start": {
-                                "line": 63,
-                                "column": 26
-                              },
-                              "end": {
-                                "line": 63,
-                                "column": 27
-                              }
-                            }
-                          },
-                          "loc": {
-                            "start": {
-                              "line": 63,
-                              "column": 13
-                            },
-                            "end": {
-                              "line": 63,
-                              "column": 27
-                            }
-                          }
-                        }
-                      ],
-                      "kind": "let",
-                      "loc": {
-                        "start": {
-                          "line": 63,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 63,
-                          "column": 28
-                        }
-                      }
-                    },
-                    {
-                      "type": "VariableDeclaration",
-                      "declarations": [
-                        {
-                          "type": "VariableDeclarator",
-                          "id": {
-                            "type": "Identifier",
-                            "name": "lenOut",
-                            "typeAnnotation": {
-                              "type": "ETSPrimitiveType",
-                              "loc": {
-                                "start": {
-                                  "line": 64,
-                                  "column": 22
-                                },
-                                "end": {
-                                  "line": 64,
-                                  "column": 25
-                                }
-                              }
-                            },
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 64,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 64,
-                                "column": 19
-                              }
-                            }
-                          },
-                          "init": {
-                            "type": "NumberLiteral",
-                            "value": 60,
-                            "loc": {
-                              "start": {
-                                "line": 64,
-                                "column": 28
-                              },
-                              "end": {
-                                "line": 64,
-                                "column": 30
-                              }
-                            }
-                          },
-                          "loc": {
-                            "start": {
-                              "line": 64,
-                              "column": 13
-                            },
-                            "end": {
-                              "line": 64,
-                              "column": 30
-                            }
-                          }
-                        }
-                      ],
-                      "kind": "let",
-                      "loc": {
-                        "start": {
-                          "line": 64,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 64,
-                          "column": 31
-                        }
-                      }
-                    },
-                    {
-                      "type": "VariableDeclaration",
-                      "declarations": [
-                        {
-                          "type": "VariableDeclarator",
-                          "id": {
-                            "type": "Identifier",
-                            "name": "ret",
-                            "typeAnnotation": {
-                              "type": "ETSPrimitiveType",
-                              "loc": {
-                                "start": {
-                                  "line": 65,
-                                  "column": 19
-                                },
-                                "end": {
-                                  "line": 65,
-                                  "column": 22
-                                }
-                              }
-                            },
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 65,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 65,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "init": {
-                            "type": "NumberLiteral",
-                            "value": 0,
-                            "loc": {
-                              "start": {
-                                "line": 65,
-                                "column": 25
-                              },
-                              "end": {
-                                "line": 65,
-                                "column": 26
-                              }
-                            }
-                          },
-                          "loc": {
-                            "start": {
-                              "line": 65,
-                              "column": 13
-                            },
-                            "end": {
-                              "line": 65,
-                              "column": 26
-                            }
-                          }
-                        }
-                      ],
-                      "kind": "let",
-                      "loc": {
-                        "start": {
-                          "line": 65,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 65,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "WhileStatement",
-                      "test": {
-                        "type": "BinaryExpression",
-                        "operator": ">",
-                        "left": {
-                          "type": "Identifier",
-                          "name": "n",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 66,
-                              "column": 15
-                            },
-                            "end": {
-                              "line": 66,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "right": {
-                          "type": "NumberLiteral",
-                          "value": 0,
-                          "loc": {
-                            "start": {
-                              "line": 66,
-                              "column": 19
-                            },
-                            "end": {
-                              "line": 66,
-                              "column": 20
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 66,
-                            "column": 15
-                          },
-                          "end": {
-                            "line": 66,
-                            "column": 20
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "IfStatement",
-                            "test": {
-                              "type": "BinaryExpression",
-                              "operator": "<",
-                              "left": {
-                                "type": "Identifier",
-                                "name": "n",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 68,
-                                    "column": 17
-                                  },
-                                  "end": {
-                                    "line": 68,
-                                    "column": 18
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "Identifier",
-                                "name": "lenOut",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 68,
-                                    "column": 21
-                                  },
-                                  "end": {
-                                    "line": 68,
-                                    "column": 27
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 68,
-                                  "column": 17
-                                },
-                                "end": {
-                                  "line": 68,
-                                  "column": 27
-                                }
-                              }
-                            },
-                            "consequent": {
-                              "type": "BlockStatement",
-                              "statements": [
-                                {
-                                  "type": "ExpressionStatement",
-                                  "expression": {
-                                    "type": "AssignmentExpression",
-                                    "operator": "=",
-                                    "left": {
-                                      "type": "Identifier",
-                                      "name": "lenOut",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 69,
-                                          "column": 17
-                                        },
-                                        "end": {
-                                          "line": 69,
-                                          "column": 23
-                                        }
-                                      }
-                                    },
-                                    "right": {
-                                      "type": "Identifier",
-                                      "name": "n",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 69,
-                                          "column": 26
-                                        },
-                                        "end": {
-                                          "line": 69,
-                                          "column": 27
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 69,
-                                        "column": 17
-                                      },
-                                      "end": {
-                                        "line": 69,
-                                        "column": 27
-                                      }
-                                    }
-                                  },
-                                  "loc": {
-                                    "start": {
-                                      "line": 69,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 69,
-                                      "column": 28
-                                    }
-                                  }
-                                }
-                              ],
-                              "loc": {
-                                "start": {
-                                  "line": 68,
-                                  "column": 29
-                                },
-                                "end": {
-                                  "line": 70,
-                                  "column": 14
-                                }
-                              }
-                            },
-                            "alternate": null,
-                            "loc": {
-                              "start": {
-                                "line": 68,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 70,
-                                "column": 14
-                              }
-                            }
-                          },
-                          {
-                            "type": "IfStatement",
-                            "test": {
-                              "type": "BinaryExpression",
-                              "operator": "<",
-                              "left": {
-                                "type": "BinaryExpression",
-                                "operator": "+",
-                                "left": {
-                                  "type": "Identifier",
-                                  "name": "seqi",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 71,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 71,
-                                      "column": 21
-                                    }
-                                  }
-                                },
-                                "right": {
-                                  "type": "Identifier",
-                                  "name": "lenOut",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 71,
-                                      "column": 24
-                                    },
-                                    "end": {
-                                      "line": 71,
-                                      "column": 30
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 71,
-                                    "column": 17
-                                  },
-                                  "end": {
-                                    "line": 71,
-                                    "column": 30
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "CallExpression",
-                                "callee": {
-                                  "type": "MemberExpression",
-                                  "object": {
-                                    "type": "Identifier",
-                                    "name": "seq",
-                                    "decorators": [],
-                                    "loc": {
-                                      "start": {
-                                        "line": 71,
-                                        "column": 33
-                                      },
-                                      "end": {
-                                        "line": 71,
-                                        "column": 36
-                                      }
-                                    }
-                                  },
-                                  "property": {
-                                    "type": "Identifier",
-                                    "name": "length",
-                                    "decorators": [],
-                                    "loc": {
-                                      "start": {
-                                        "line": 71,
-                                        "column": 37
-                                      },
-                                      "end": {
-                                        "line": 71,
-                                        "column": 43
-                                      }
-                                    }
-                                  },
-                                  "computed": false,
-                                  "optional": false,
-                                  "loc": {
-                                    "start": {
-                                      "line": 71,
-                                      "column": 33
-                                    },
-                                    "end": {
-                                      "line": 71,
-                                      "column": 43
-                                    }
-                                  }
-                                },
-                                "arguments": [],
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 71,
-                                    "column": 33
-                                  },
-                                  "end": {
-                                    "line": 71,
-                                    "column": 45
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 71,
-                                  "column": 17
-                                },
-                                "end": {
-                                  "line": 71,
-                                  "column": 45
-                                }
-                              }
-                            },
-                            "consequent": {
-                              "type": "BlockStatement",
-                              "statements": [
-                                {
-                                  "type": "ExpressionStatement",
-                                  "expression": {
-                                    "type": "AssignmentExpression",
-                                    "operator": "+=",
-                                    "left": {
-                                      "type": "Identifier",
-                                      "name": "ret",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 72,
-                                          "column": 17
-                                        },
-                                        "end": {
-                                          "line": 72,
-                                          "column": 20
-                                        }
-                                      }
-                                    },
-                                    "right": {
-                                      "type": "CallExpression",
-                                      "callee": {
-                                        "type": "MemberExpression",
-                                        "object": {
-                                          "type": "CallExpression",
-                                          "callee": {
-                                            "type": "MemberExpression",
-                                            "object": {
-                                              "type": "Identifier",
-                                              "name": "seq",
-                                              "decorators": [],
-                                              "loc": {
-                                                "start": {
-                                                  "line": 72,
-                                                  "column": 24
-                                                },
-                                                "end": {
-                                                  "line": 72,
-                                                  "column": 27
-                                                }
-                                              }
-                                            },
-                                            "property": {
-                                              "type": "Identifier",
-                                              "name": "substring",
-                                              "decorators": [],
-                                              "loc": {
-                                                "start": {
-                                                  "line": 72,
-                                                  "column": 28
-                                                },
-                                                "end": {
-                                                  "line": 72,
-                                                  "column": 37
-                                                }
-                                              }
-                                            },
-                                            "computed": false,
-                                            "optional": false,
-                                            "loc": {
-                                              "start": {
-                                                "line": 72,
-                                                "column": 24
-                                              },
-                                              "end": {
-                                                "line": 72,
-                                                "column": 37
-                                              }
-                                            }
-                                          },
-                                          "arguments": [
-                                            {
-                                              "type": "Identifier",
-                                              "name": "seqi",
-                                              "decorators": [],
-                                              "loc": {
-                                                "start": {
-                                                  "line": 72,
-                                                  "column": 38
-                                                },
-                                                "end": {
-                                                  "line": 72,
-                                                  "column": 42
-                                                }
-                                              }
-                                            },
-                                            {
-                                              "type": "BinaryExpression",
-                                              "operator": "+",
-                                              "left": {
-                                                "type": "Identifier",
-                                                "name": "seqi",
-                                                "decorators": [],
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 72,
-                                                    "column": 44
-                                                  },
-                                                  "end": {
-                                                    "line": 72,
-                                                    "column": 48
-                                                  }
-                                                }
-                                              },
-                                              "right": {
-                                                "type": "Identifier",
-                                                "name": "lenOut",
-                                                "decorators": [],
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 72,
-                                                    "column": 51
-                                                  },
-                                                  "end": {
-                                                    "line": 72,
-                                                    "column": 57
-                                                  }
-                                                }
-                                              },
-                                              "loc": {
-                                                "start": {
-                                                  "line": 72,
-                                                  "column": 44
-                                                },
-                                                "end": {
-                                                  "line": 72,
-                                                  "column": 57
-                                                }
-                                              }
-                                            }
-                                          ],
-                                          "optional": false,
-                                          "loc": {
-                                            "start": {
-                                              "line": 72,
-                                              "column": 24
-                                            },
-                                            "end": {
-                                              "line": 72,
-                                              "column": 58
-                                            }
-                                          }
-                                        },
-                                        "property": {
-                                          "type": "Identifier",
-                                          "name": "length",
-                                          "decorators": [],
-                                          "loc": {
-                                            "start": {
-                                              "line": 72,
-                                              "column": 59
-                                            },
-                                            "end": {
-                                              "line": 72,
-                                              "column": 65
-                                            }
-                                          }
-                                        },
-                                        "computed": false,
-                                        "optional": false,
-                                        "loc": {
-                                          "start": {
-                                            "line": 72,
-                                            "column": 24
-                                          },
-                                          "end": {
-                                            "line": 72,
-                                            "column": 65
-                                          }
-                                        }
-                                      },
-                                      "arguments": [],
-                                      "optional": false,
-                                      "loc": {
-                                        "start": {
-                                          "line": 72,
-                                          "column": 24
-                                        },
-                                        "end": {
-                                          "line": 72,
-                                          "column": 67
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 72,
-                                        "column": 17
-                                      },
-                                      "end": {
-                                        "line": 72,
-                                        "column": 67
-                                      }
-                                    }
-                                  },
-                                  "loc": {
-                                    "start": {
-                                      "line": 72,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 72,
-                                      "column": 68
-                                    }
-                                  }
-                                },
-                                {
-                                  "type": "ExpressionStatement",
-                                  "expression": {
-                                    "type": "AssignmentExpression",
-                                    "operator": "+=",
-                                    "left": {
-                                      "type": "Identifier",
-                                      "name": "seqi",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 73,
-                                          "column": 17
-                                        },
-                                        "end": {
-                                          "line": 73,
-                                          "column": 21
-                                        }
-                                      }
-                                    },
-                                    "right": {
-                                      "type": "Identifier",
-                                      "name": "lenOut",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 73,
-                                          "column": 25
-                                        },
-                                        "end": {
-                                          "line": 73,
-                                          "column": 31
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 73,
-                                        "column": 17
-                                      },
-                                      "end": {
-                                        "line": 73,
-                                        "column": 31
-                                      }
-                                    }
-                                  },
-                                  "loc": {
-                                    "start": {
-                                      "line": 73,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 73,
-                                      "column": 32
-                                    }
-                                  }
-                                }
-                              ],
-                              "loc": {
-                                "start": {
-                                  "line": 71,
-                                  "column": 47
-                                },
-                                "end": {
-                                  "line": 74,
-                                  "column": 14
-                                }
-                              }
-                            },
-                            "alternate": {
-                              "type": "BlockStatement",
-                              "statements": [
-                                {
-                                  "type": "VariableDeclaration",
-                                  "declarations": [
-                                    {
-                                      "type": "VariableDeclarator",
-                                      "id": {
-                                        "type": "Identifier",
-                                        "name": "s",
-                                        "typeAnnotation": {
-                                          "type": "ETSTypeReference",
-                                          "part": {
-                                            "type": "ETSTypeReferencePart",
-                                            "name": {
-                                              "type": "Identifier",
-                                              "name": "String",
-                                              "decorators": [],
-                                              "loc": {
-                                                "start": {
-                                                  "line": 76,
-                                                  "column": 25
-                                                },
-                                                "end": {
-                                                  "line": 76,
-                                                  "column": 31
-                                                }
-                                              }
-                                            },
-                                            "loc": {
-                                              "start": {
-                                                "line": 76,
-                                                "column": 25
-                                              },
-                                              "end": {
-                                                "line": 76,
-                                                "column": 33
-                                              }
-                                            }
-                                          },
-                                          "loc": {
-                                            "start": {
-                                              "line": 76,
-                                              "column": 25
-                                            },
-                                            "end": {
-                                              "line": 76,
-                                              "column": 33
-                                            }
-                                          }
-                                        },
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 76,
-                                            "column": 21
-                                          },
-                                          "end": {
-                                            "line": 76,
-                                            "column": 22
-                                          }
-                                        }
-                                      },
-                                      "init": {
-                                        "type": "CallExpression",
-                                        "callee": {
-                                          "type": "MemberExpression",
-                                          "object": {
-                                            "type": "Identifier",
-                                            "name": "seq",
-                                            "decorators": [],
-                                            "loc": {
-                                              "start": {
-                                                "line": 76,
-                                                "column": 34
-                                              },
-                                              "end": {
-                                                "line": 76,
-                                                "column": 37
-                                              }
-                                            }
-                                          },
-                                          "property": {
-                                            "type": "Identifier",
-                                            "name": "substring",
-                                            "decorators": [],
-                                            "loc": {
-                                              "start": {
-                                                "line": 76,
-                                                "column": 38
-                                              },
-                                              "end": {
-                                                "line": 76,
-                                                "column": 47
-                                              }
-                                            }
-                                          },
-                                          "computed": false,
-                                          "optional": false,
-                                          "loc": {
-                                            "start": {
-                                              "line": 76,
-                                              "column": 34
-                                            },
-                                            "end": {
-                                              "line": 76,
-                                              "column": 47
-                                            }
-                                          }
-                                        },
-                                        "arguments": [
-                                          {
-                                            "type": "Identifier",
-                                            "name": "seqi",
-                                            "decorators": [],
-                                            "loc": {
-                                              "start": {
-                                                "line": 76,
-                                                "column": 48
-                                              },
-                                              "end": {
-                                                "line": 76,
-                                                "column": 52
-                                              }
-                                            }
-                                          }
-                                        ],
-                                        "optional": false,
-                                        "loc": {
-                                          "start": {
-                                            "line": 76,
-                                            "column": 34
-                                          },
-                                          "end": {
-                                            "line": 76,
-                                            "column": 53
-                                          }
-                                        }
-                                      },
-                                      "loc": {
-                                        "start": {
-                                          "line": 76,
-                                          "column": 21
-                                        },
-                                        "end": {
-                                          "line": 76,
-                                          "column": 53
-                                        }
-                                      }
-                                    }
-                                  ],
-                                  "kind": "let",
-                                  "loc": {
-                                    "start": {
-                                      "line": 76,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 76,
-                                      "column": 54
-                                    }
-                                  }
-                                },
-                                {
-                                  "type": "ExpressionStatement",
-                                  "expression": {
-                                    "type": "AssignmentExpression",
-                                    "operator": "=",
-                                    "left": {
-                                      "type": "Identifier",
-                                      "name": "seqi",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 77,
-                                          "column": 17
-                                        },
-                                        "end": {
-                                          "line": 77,
-                                          "column": 21
-                                        }
-                                      }
-                                    },
-                                    "right": {
-                                      "type": "BinaryExpression",
-                                      "operator": "-",
-                                      "left": {
-                                        "type": "Identifier",
-                                        "name": "lenOut",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 77,
-                                            "column": 24
-                                          },
-                                          "end": {
-                                            "line": 77,
-                                            "column": 30
-                                          }
-                                        }
-                                      },
-                                      "right": {
-                                        "type": "CallExpression",
-                                        "callee": {
-                                          "type": "MemberExpression",
-                                          "object": {
-                                            "type": "Identifier",
-                                            "name": "s",
-                                            "decorators": [],
-                                            "loc": {
-                                              "start": {
-                                                "line": 77,
-                                                "column": 33
-                                              },
-                                              "end": {
-                                                "line": 77,
-                                                "column": 34
-                                              }
-                                            }
-                                          },
-                                          "property": {
-                                            "type": "Identifier",
-                                            "name": "length",
-                                            "decorators": [],
-                                            "loc": {
-                                              "start": {
-                                                "line": 77,
-                                                "column": 35
-                                              },
-                                              "end": {
-                                                "line": 77,
-                                                "column": 41
-                                              }
-                                            }
-                                          },
-                                          "computed": false,
-                                          "optional": false,
-                                          "loc": {
-                                            "start": {
-                                              "line": 77,
-                                              "column": 33
-                                            },
-                                            "end": {
-                                              "line": 77,
-                                              "column": 41
-                                            }
-                                          }
-                                        },
-                                        "arguments": [],
-                                        "optional": false,
-                                        "loc": {
-                                          "start": {
-                                            "line": 77,
-                                            "column": 33
-                                          },
-                                          "end": {
-                                            "line": 77,
-                                            "column": 43
-                                          }
-                                        }
-                                      },
-                                      "loc": {
-                                        "start": {
-                                          "line": 77,
-                                          "column": 24
-                                        },
-                                        "end": {
-                                          "line": 77,
-                                          "column": 43
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 77,
-                                        "column": 17
-                                      },
-                                      "end": {
-                                        "line": 77,
-                                        "column": 43
-                                      }
-                                    }
-                                  },
-                                  "loc": {
-                                    "start": {
-                                      "line": 77,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 77,
-                                      "column": 44
-                                    }
-                                  }
-                                },
-                                {
-                                  "type": "ExpressionStatement",
-                                  "expression": {
-                                    "type": "AssignmentExpression",
-                                    "operator": "+=",
-                                    "left": {
-                                      "type": "Identifier",
-                                      "name": "ret",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 78,
-                                          "column": 17
-                                        },
-                                        "end": {
-                                          "line": 78,
-                                          "column": 20
-                                        }
-                                      }
-                                    },
-                                    "right": {
-                                      "type": "CallExpression",
-                                      "callee": {
-                                        "type": "MemberExpression",
-                                        "object": {
-                                          "type": "BinaryExpression",
-                                          "operator": "+",
-                                          "left": {
-                                            "type": "Identifier",
-                                            "name": "s",
-                                            "decorators": [],
-                                            "loc": {
-                                              "start": {
-                                                "line": 78,
-                                                "column": 25
-                                              },
-                                              "end": {
-                                                "line": 78,
-                                                "column": 26
-                                              }
-                                            }
-                                          },
-                                          "right": {
-                                            "type": "CallExpression",
-                                            "callee": {
-                                              "type": "MemberExpression",
-                                              "object": {
-                                                "type": "Identifier",
-                                                "name": "seq",
-                                                "decorators": [],
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 78,
-                                                    "column": 29
-                                                  },
-                                                  "end": {
-                                                    "line": 78,
-                                                    "column": 32
-                                                  }
-                                                }
-                                              },
-                                              "property": {
-                                                "type": "Identifier",
-                                                "name": "substring",
-                                                "decorators": [],
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 78,
-                                                    "column": 33
-                                                  },
-                                                  "end": {
-                                                    "line": 78,
-                                                    "column": 42
-                                                  }
-                                                }
-                                              },
-                                              "computed": false,
-                                              "optional": false,
-                                              "loc": {
-                                                "start": {
-                                                  "line": 78,
-                                                  "column": 29
-                                                },
-                                                "end": {
-                                                  "line": 78,
-                                                  "column": 42
-                                                }
-                                              }
-                                            },
-                                            "arguments": [
-                                              {
-                                                "type": "NumberLiteral",
-                                                "value": 0,
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 78,
-                                                    "column": 43
-                                                  },
-                                                  "end": {
-                                                    "line": 78,
-                                                    "column": 44
-                                                  }
-                                                }
-                                              },
-                                              {
-                                                "type": "Identifier",
-                                                "name": "seqi",
-                                                "decorators": [],
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 78,
-                                                    "column": 46
-                                                  },
-                                                  "end": {
-                                                    "line": 78,
-                                                    "column": 50
-                                                  }
-                                                }
-                                              }
-                                            ],
-                                            "optional": false,
-                                            "loc": {
-                                              "start": {
-                                                "line": 78,
-                                                "column": 29
-                                              },
-                                              "end": {
-                                                "line": 78,
-                                                "column": 51
-                                              }
-                                            }
-                                          },
-                                          "loc": {
-                                            "start": {
-                                              "line": 78,
-                                              "column": 24
-                                            },
-                                            "end": {
-                                              "line": 78,
-                                              "column": 52
-                                            }
-                                          }
-                                        },
-                                        "property": {
-                                          "type": "Identifier",
-                                          "name": "length",
-                                          "decorators": [],
-                                          "loc": {
-                                            "start": {
-                                              "line": 78,
-                                              "column": 53
-                                            },
-                                            "end": {
-                                              "line": 78,
-                                              "column": 59
-                                            }
-                                          }
-                                        },
-                                        "computed": false,
-                                        "optional": false,
-                                        "loc": {
-                                          "start": {
-                                            "line": 78,
-                                            "column": 24
-                                          },
-                                          "end": {
-                                            "line": 78,
-                                            "column": 59
-                                          }
-                                        }
-                                      },
-                                      "arguments": [],
-                                      "optional": false,
-                                      "loc": {
-                                        "start": {
-                                          "line": 78,
-                                          "column": 24
-                                        },
-                                        "end": {
-                                          "line": 78,
-                                          "column": 61
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 78,
-                                        "column": 17
-                                      },
-                                      "end": {
-                                        "line": 78,
-                                        "column": 61
-                                      }
-                                    }
-                                  },
-                                  "loc": {
-                                    "start": {
-                                      "line": 78,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 78,
-                                      "column": 62
-                                    }
-                                  }
-                                }
-                              ],
-                              "loc": {
-                                "start": {
-                                  "line": 75,
-                                  "column": 18
-                                },
-                                "end": {
-                                  "line": 79,
-                                  "column": 14
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 71,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 79,
-                                "column": 14
-                              }
-                            }
-                          },
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "AssignmentExpression",
-                              "operator": "-=",
-                              "left": {
-                                "type": "Identifier",
-                                "name": "n",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 80,
-                                    "column": 13
-                                  },
-                                  "end": {
-                                    "line": 80,
-                                    "column": 14
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "Identifier",
-                                "name": "lenOut",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 80,
-                                    "column": 18
-                                  },
-                                  "end": {
-                                    "line": 80,
-                                    "column": 24
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 80,
-                                  "column": 13
-                                },
-                                "end": {
-                                  "line": 80,
-                                  "column": 24
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 80,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 80,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 67,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 81,
-                            "column": 10
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 66,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 81,
-                          "column": 10
-                        }
-                      }
-                    },
-                    {
-                      "type": "ReturnStatement",
-                      "argument": {
-                        "type": "Identifier",
-                        "name": "ret",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 82,
-                            "column": 16
-                          },
-                          "end": {
-                            "line": 82,
-                            "column": 19
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 82,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 82,
-                          "column": 20
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 62,
-                      "column": 52
-                    },
-                    "end": {
-                      "line": 83,
-                      "column": 6
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 62,
-                    "column": 23
-                  },
-                  "end": {
-                    "line": 83,
-                    "column": 6
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 62,
-                  "column": 23
-                },
-                "end": {
-                  "line": 83,
-                  "column": 6
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 62,
-                "column": 5
-              },
-              "end": {
-                "line": 83,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "fastaRandom",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 84,
-                  "column": 12
-                },
-                "end": {
-                  "line": 84,
-                  "column": 23
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": true,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "fastaRandom",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 84,
-                      "column": 12
-                    },
-                    "end": {
-                      "line": 84,
-                      "column": 23
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [
-                  {
-                    "type": "Identifier",
-                    "name": "n",
-                    "typeAnnotation": {
-                      "type": "ETSPrimitiveType",
-                      "loc": {
-                        "start": {
-                          "line": 84,
-                          "column": 28
-                        },
-                        "end": {
-                          "line": 84,
-                          "column": 31
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 84,
-                        "column": 24
-                      },
-                      "end": {
-                        "line": 84,
-                        "column": 31
-                      }
-                    }
-                  },
-                  {
-                    "type": "Identifier",
-                    "name": "table",
-                    "typeAnnotation": {
-                      "type": "ETSTypeReference",
-                      "part": {
-                        "type": "ETSTypeReferencePart",
-                        "name": {
-                          "type": "Identifier",
-                          "name": "HashMap",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 84,
-                              "column": 41
-                            },
-                            "end": {
-                              "line": 84,
-                              "column": 48
-                            }
-                          }
-                        },
-                        "typeParams": {
-                          "type": "TSTypeParameterInstantiation",
-                          "params": [
-                            {
-                              "type": "ETSTypeReference",
-                              "part": {
-                                "type": "ETSTypeReferencePart",
-                                "name": {
-                                  "type": "Identifier",
-                                  "name": "Char",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 84,
-                                      "column": 49
-                                    },
-                                    "end": {
-                                      "line": 84,
-                                      "column": 53
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 84,
-                                    "column": 49
-                                  },
-                                  "end": {
-                                    "line": 84,
-                                    "column": 54
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 84,
-                                  "column": 49
-                                },
-                                "end": {
-                                  "line": 84,
-                                  "column": 54
-                                }
-                              }
-                            },
-                            {
-                              "type": "ETSTypeReference",
-                              "part": {
-                                "type": "ETSTypeReferencePart",
-                                "name": {
-                                  "type": "Identifier",
-                                  "name": "Double",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 84,
-                                      "column": 55
-                                    },
-                                    "end": {
-                                      "line": 84,
-                                      "column": 61
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 84,
-                                    "column": 55
-                                  },
-                                  "end": {
-                                    "line": 84,
-                                    "column": 62
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 84,
-                                  "column": 55
-                                },
-                                "end": {
-                                  "line": 84,
-                                  "column": 62
-                                }
-                              }
-                            }
-                          ],
-                          "loc": {
-                            "start": {
-                              "line": 84,
-                              "column": 48
-                            },
-                            "end": {
-                              "line": 84,
-                              "column": 62
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 84,
-                            "column": 41
-                          },
-                          "end": {
-                            "line": 84,
-                            "column": 63
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 84,
-                          "column": 41
-                        },
-                        "end": {
-                          "line": 84,
-                          "column": 63
-                        }
-                      }
-                    },
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 84,
-                        "column": 33
-                      },
-                      "end": {
-                        "line": 84,
-                        "column": 63
-                      }
-                    }
-                  }
-                ],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 84,
-                      "column": 65
-                    },
-                    "end": {
-                      "line": 84,
-                      "column": 68
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [
-                    {
-                      "type": "VariableDeclaration",
-                      "declarations": [
-                        {
-                          "type": "VariableDeclarator",
-                          "id": {
-                            "type": "Identifier",
-                            "name": "line",
-                            "typeAnnotation": {
-                              "type": "TSArrayType",
-                              "elementType": {
-                                "type": "ETSPrimitiveType",
-                                "loc": {
-                                  "start": {
-                                    "line": 85,
-                                    "column": 20
-                                  },
-                                  "end": {
-                                    "line": 85,
-                                    "column": 24
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 85,
-                                  "column": 27
-                                },
-                                "end": {
-                                  "line": 85,
-                                  "column": 28
-                                }
-                              }
-                            },
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 85,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 85,
-                                "column": 17
-                              }
-                            }
-                          },
-                          "init": {
-                            "type": "ETSNewArrayInstanceExpression",
-                            "typeReference": {
-                              "type": "ETSPrimitiveType",
-                              "loc": {
-                                "start": {
-                                  "line": 85,
-                                  "column": 33
-                                },
-                                "end": {
-                                  "line": 85,
-                                  "column": 37
-                                }
-                              }
-                            },
-                            "dimension": {
-                              "type": "NumberLiteral",
-                              "value": 60,
-                              "loc": {
-                                "start": {
-                                  "line": 85,
-                                  "column": 38
-                                },
-                                "end": {
-                                  "line": 85,
-                                  "column": 40
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 85,
-                                "column": 29
-                              },
-                              "end": {
-                                "line": 85,
-                                "column": 41
-                              }
-                            }
-                          },
-                          "loc": {
-                            "start": {
-                              "line": 85,
-                              "column": 13
-                            },
-                            "end": {
-                              "line": 85,
-                              "column": 41
-                            }
-                          }
-                        }
-                      ],
-                      "kind": "let",
-                      "loc": {
-                        "start": {
-                          "line": 85,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 85,
-                          "column": 42
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "Identifier",
-                          "name": "makeCumulative",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 86,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 86,
-                              "column": 23
-                            }
-                          }
-                        },
-                        "arguments": [
-                          {
-                            "type": "Identifier",
-                            "name": "table",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 86,
-                                "column": 24
-                              },
-                              "end": {
-                                "line": 86,
-                                "column": 29
-                              }
-                            }
-                          }
-                        ],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 86,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 86,
-                            "column": 30
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 86,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 86,
-                          "column": 31
-                        }
-                      }
-                    },
-                    {
-                      "type": "VariableDeclaration",
-                      "declarations": [
-                        {
-                          "type": "VariableDeclarator",
-                          "id": {
-                            "type": "Identifier",
-                            "name": "ret",
-                            "typeAnnotation": {
-                              "type": "ETSPrimitiveType",
-                              "loc": {
-                                "start": {
-                                  "line": 87,
-                                  "column": 19
-                                },
-                                "end": {
-                                  "line": 87,
-                                  "column": 22
-                                }
-                              }
-                            },
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 87,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 87,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "init": {
-                            "type": "NumberLiteral",
-                            "value": 0,
-                            "loc": {
-                              "start": {
-                                "line": 87,
-                                "column": 25
-                              },
-                              "end": {
-                                "line": 87,
-                                "column": 26
-                              }
-                            }
-                          },
-                          "loc": {
-                            "start": {
-                              "line": 87,
-                              "column": 13
-                            },
-                            "end": {
-                              "line": 87,
-                              "column": 26
-                            }
-                          }
-                        }
-                      ],
-                      "kind": "let",
-                      "loc": {
-                        "start": {
-                          "line": 87,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 87,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "WhileStatement",
-                      "test": {
-                        "type": "BinaryExpression",
-                        "operator": ">",
-                        "left": {
-                          "type": "Identifier",
-                          "name": "n",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 88,
-                              "column": 15
-                            },
-                            "end": {
-                              "line": 88,
-                              "column": 16
-                            }
-                          }
-                        },
-                        "right": {
-                          "type": "NumberLiteral",
-                          "value": 0,
-                          "loc": {
-                            "start": {
-                              "line": 88,
-                              "column": 19
-                            },
-                            "end": {
-                              "line": 88,
-                              "column": 20
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 88,
-                            "column": 15
-                          },
-                          "end": {
-                            "line": 88,
-                            "column": 20
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "IfStatement",
-                            "test": {
-                              "type": "BinaryExpression",
-                              "operator": "<",
-                              "left": {
-                                "type": "Identifier",
-                                "name": "n",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 90,
-                                    "column": 17
-                                  },
-                                  "end": {
-                                    "line": 90,
-                                    "column": 18
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "Identifier",
-                                  "name": "line",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 90,
-                                      "column": 21
-                                    },
-                                    "end": {
-                                      "line": 90,
-                                      "column": 25
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "length",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 90,
-                                      "column": 26
-                                    },
-                                    "end": {
-                                      "line": 90,
-                                      "column": 32
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 90,
-                                    "column": 21
-                                  },
-                                  "end": {
-                                    "line": 90,
-                                    "column": 32
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 90,
-                                  "column": 17
-                                },
-                                "end": {
-                                  "line": 90,
-                                  "column": 32
-                                }
-                              }
-                            },
-                            "consequent": {
-                              "type": "BlockStatement",
-                              "statements": [
-                                {
-                                  "type": "ExpressionStatement",
-                                  "expression": {
-                                    "type": "AssignmentExpression",
-                                    "operator": "=",
-                                    "left": {
-                                      "type": "Identifier",
-                                      "name": "line",
-                                      "decorators": [],
-                                      "loc": {
-                                        "start": {
-                                          "line": 91,
-                                          "column": 17
-                                        },
-                                        "end": {
-                                          "line": 91,
-                                          "column": 21
-                                        }
-                                      }
-                                    },
-                                    "right": {
-                                      "type": "ETSNewArrayInstanceExpression",
-                                      "typeReference": {
-                                        "type": "ETSPrimitiveType",
-                                        "loc": {
-                                          "start": {
-                                            "line": 91,
-                                            "column": 28
-                                          },
-                                          "end": {
-                                            "line": 91,
-                                            "column": 32
-                                          }
-                                        }
-                                      },
-                                      "dimension": {
-                                        "type": "Identifier",
-                                        "name": "n",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 91,
-                                            "column": 33
-                                          },
-                                          "end": {
-                                            "line": 91,
-                                            "column": 34
-                                          }
-                                        }
-                                      },
-                                      "loc": {
-                                        "start": {
-                                          "line": 91,
-                                          "column": 24
-                                        },
-                                        "end": {
-                                          "line": 91,
-                                          "column": 35
-                                        }
-                                      }
-                                    },
-                                    "loc": {
-                                      "start": {
-                                        "line": 91,
-                                        "column": 17
-                                      },
-                                      "end": {
-                                        "line": 91,
-                                        "column": 35
-                                      }
-                                    }
-                                  },
-                                  "loc": {
-                                    "start": {
-                                      "line": 91,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 91,
-                                      "column": 36
-                                    }
-                                  }
-                                }
-                              ],
-                              "loc": {
-                                "start": {
-                                  "line": 90,
-                                  "column": 34
-                                },
-                                "end": {
-                                  "line": 92,
-                                  "column": 14
-                                }
-                              }
-                            },
-                            "alternate": null,
-                            "loc": {
-                              "start": {
-                                "line": 90,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 92,
-                                "column": 14
-                              }
-                            }
-                          },
-                          {
-                            "type": "ForUpdateStatement",
-                            "init": {
-                              "type": "VariableDeclaration",
-                              "declarations": [
-                                {
-                                  "type": "VariableDeclarator",
-                                  "id": {
-                                    "type": "Identifier",
-                                    "name": "i",
-                                    "typeAnnotation": {
-                                      "type": "ETSPrimitiveType",
-                                      "loc": {
-                                        "start": {
-                                          "line": 93,
-                                          "column": 26
-                                        },
-                                        "end": {
-                                          "line": 93,
-                                          "column": 29
-                                        }
-                                      }
-                                    },
-                                    "decorators": [],
-                                    "loc": {
-                                      "start": {
-                                        "line": 93,
-                                        "column": 22
-                                      },
-                                      "end": {
-                                        "line": 93,
-                                        "column": 23
-                                      }
-                                    }
-                                  },
-                                  "init": {
-                                    "type": "NumberLiteral",
-                                    "value": 0,
-                                    "loc": {
-                                      "start": {
-                                        "line": 93,
-                                        "column": 32
-                                      },
-                                      "end": {
-                                        "line": 93,
-                                        "column": 33
-                                      }
-                                    }
-                                  },
-                                  "loc": {
-                                    "start": {
-                                      "line": 93,
-                                      "column": 22
-                                    },
-                                    "end": {
-                                      "line": 93,
-                                      "column": 33
-                                    }
-                                  }
-                                }
-                              ],
-                              "kind": "let",
-                              "loc": {
-                                "start": {
-                                  "line": 93,
-                                  "column": 18
-                                },
-                                "end": {
-                                  "line": 93,
-                                  "column": 33
-                                }
-                              }
-                            },
-                            "test": {
-                              "type": "BinaryExpression",
-                              "operator": "<",
-                              "left": {
-                                "type": "Identifier",
-                                "name": "i",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 93,
-                                    "column": 35
-                                  },
-                                  "end": {
-                                    "line": 93,
-                                    "column": 36
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "Identifier",
-                                  "name": "line",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 93,
-                                      "column": 39
-                                    },
-                                    "end": {
-                                      "line": 93,
-                                      "column": 43
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "length",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 93,
-                                      "column": 44
-                                    },
-                                    "end": {
-                                      "line": 93,
-                                      "column": 50
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 93,
-                                    "column": 39
-                                  },
-                                  "end": {
-                                    "line": 93,
-                                    "column": 50
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 93,
-                                  "column": 35
-                                },
-                                "end": {
-                                  "line": 93,
-                                  "column": 50
-                                }
-                              }
-                            },
-                            "update": {
-                              "type": "UpdateExpression",
-                              "operator": "++",
-                              "prefix": false,
-                              "argument": {
-                                "type": "Identifier",
-                                "name": "i",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 93,
-                                    "column": 52
-                                  },
-                                  "end": {
-                                    "line": 93,
-                                    "column": 53
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 93,
-                                  "column": 52
-                                },
-                                "end": {
-                                  "line": 93,
-                                  "column": 55
-                                }
-                              }
-                            },
-                            "body": {
-                              "type": "BlockStatement",
-                              "statements": [
-                                {
-                                  "type": "VariableDeclaration",
-                                  "declarations": [
-                                    {
-                                      "type": "VariableDeclarator",
-                                      "id": {
-                                        "type": "Identifier",
-                                        "name": "r",
-                                        "typeAnnotation": {
-                                          "type": "ETSPrimitiveType",
-                                          "loc": {
-                                            "start": {
-                                              "line": 94,
-                                              "column": 25
-                                            },
-                                            "end": {
-                                              "line": 94,
-                                              "column": 31
-                                            }
-                                          }
-                                        },
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 94,
-                                            "column": 21
-                                          },
-                                          "end": {
-                                            "line": 94,
-                                            "column": 22
-                                          }
-                                        }
-                                      },
-                                      "init": {
-                                        "type": "CallExpression",
-                                        "callee": {
-                                          "type": "MemberExpression",
-                                          "object": {
-                                            "type": "Identifier",
-                                            "name": "Random",
-                                            "decorators": [],
-                                            "loc": {
-                                              "start": {
-                                                "line": 94,
-                                                "column": 34
-                                              },
-                                              "end": {
-                                                "line": 94,
-                                                "column": 40
-                                              }
-                                            }
-                                          },
-                                          "property": {
-                                            "type": "Identifier",
-                                            "name": "rand",
-                                            "decorators": [],
-                                            "loc": {
-                                              "start": {
-                                                "line": 94,
-                                                "column": 41
-                                              },
-                                              "end": {
-                                                "line": 94,
-                                                "column": 45
-                                              }
-                                            }
-                                          },
-                                          "computed": false,
-                                          "optional": false,
-                                          "loc": {
-                                            "start": {
-                                              "line": 94,
-                                              "column": 34
-                                            },
-                                            "end": {
-                                              "line": 94,
-                                              "column": 45
-                                            }
-                                          }
-                                        },
-                                        "arguments": [
-                                          {
-                                            "type": "NumberLiteral",
-                                            "value": 1,
-                                            "loc": {
-                                              "start": {
-                                                "line": 94,
-                                                "column": 46
-                                              },
-                                              "end": {
-                                                "line": 94,
-                                                "column": 47
-                                              }
-                                            }
-                                          }
-                                        ],
-                                        "optional": false,
-                                        "loc": {
-                                          "start": {
-                                            "line": 94,
-                                            "column": 34
-                                          },
-                                          "end": {
-                                            "line": 94,
-                                            "column": 48
-                                          }
-                                        }
-                                      },
-                                      "loc": {
-                                        "start": {
-                                          "line": 94,
-                                          "column": 21
-                                        },
-                                        "end": {
-                                          "line": 94,
-                                          "column": 48
-                                        }
-                                      }
-                                    }
-                                  ],
-                                  "kind": "let",
-                                  "loc": {
-                                    "start": {
-                                      "line": 94,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 94,
-                                      "column": 49
-                                    }
-                                  }
-                                },
-                                {
-                                  "type": "ForOfStatement",
-                                  "await": false,
-                                  "left": {
-                                    "type": "VariableDeclaration",
-                                    "declarations": [
-                                      {
-                                        "type": "VariableDeclarator",
-                                        "id": {
-                                          "type": "Identifier",
-                                          "name": "entry",
-                                          "typeAnnotation": {
-                                            "type": "ETSTypeReference",
-                                            "part": {
-                                              "type": "ETSTypeReferencePart",
-                                              "name": {
-                                                "type": "TSQualifiedName",
-                                                "left": {
-                                                  "type": "Identifier",
-                                                  "name": "HashMap",
-                                                  "decorators": [],
-                                                  "loc": {
-                                                    "start": {
-                                                      "line": 95,
-                                                      "column": 34
-                                                    },
-                                                    "end": {
-                                                      "line": 95,
-                                                      "column": 41
-                                                    }
-                                                  }
-                                                },
-                                                "right": {
-                                                  "type": "Identifier",
-                                                  "name": "Entry",
-                                                  "decorators": [],
-                                                  "loc": {
-                                                    "start": {
-                                                      "line": 95,
-                                                      "column": 42
-                                                    },
-                                                    "end": {
-                                                      "line": 95,
-                                                      "column": 47
-                                                    }
-                                                  }
-                                                },
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 95,
-                                                    "column": 34
-                                                  },
-                                                  "end": {
-                                                    "line": 95,
-                                                    "column": 48
-                                                  }
-                                                }
-                                              },
-                                              "typeParams": {
-                                                "type": "TSTypeParameterInstantiation",
-                                                "params": [
-                                                  {
-                                                    "type": "ETSTypeReference",
-                                                    "part": {
-                                                      "type": "ETSTypeReferencePart",
-                                                      "name": {
-                                                        "type": "Identifier",
-                                                        "name": "Char",
-                                                        "decorators": [],
-                                                        "loc": {
-                                                          "start": {
-                                                            "line": 95,
-                                                            "column": 48
-                                                          },
-                                                          "end": {
-                                                            "line": 95,
-                                                            "column": 52
-                                                          }
-                                                        }
-                                                      },
-                                                      "loc": {
-                                                        "start": {
-                                                          "line": 95,
-                                                          "column": 48
-                                                        },
-                                                        "end": {
-                                                          "line": 95,
-                                                          "column": 53
-                                                        }
-                                                      }
-                                                    },
-                                                    "loc": {
-                                                      "start": {
-                                                        "line": 95,
-                                                        "column": 48
-                                                      },
-                                                      "end": {
-                                                        "line": 95,
-                                                        "column": 53
-                                                      }
-                                                    }
-                                                  },
-                                                  {
-                                                    "type": "ETSTypeReference",
-                                                    "part": {
-                                                      "type": "ETSTypeReferencePart",
-                                                      "name": {
-                                                        "type": "Identifier",
-                                                        "name": "Double",
-                                                        "decorators": [],
-                                                        "loc": {
-                                                          "start": {
-                                                            "line": 95,
-                                                            "column": 54
-                                                          },
-                                                          "end": {
-                                                            "line": 95,
-                                                            "column": 60
-                                                          }
-                                                        }
-                                                      },
-                                                      "loc": {
-                                                        "start": {
-                                                          "line": 95,
-                                                          "column": 54
-                                                        },
-                                                        "end": {
-                                                          "line": 95,
-                                                          "column": 61
-                                                        }
-                                                      }
-                                                    },
-                                                    "loc": {
-                                                      "start": {
-                                                        "line": 95,
-                                                        "column": 54
-                                                      },
-                                                      "end": {
-                                                        "line": 95,
-                                                        "column": 61
-                                                      }
-                                                    }
-                                                  }
-                                                ],
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 95,
-                                                    "column": 47
-                                                  },
-                                                  "end": {
-                                                    "line": 95,
-                                                    "column": 61
-                                                  }
-                                                }
-                                              },
-                                              "loc": {
-                                                "start": {
-                                                  "line": 95,
-                                                  "column": 34
-                                                },
-                                                "end": {
-                                                  "line": 95,
-                                                  "column": 64
-                                                }
-                                              }
-                                            },
-                                            "loc": {
-                                              "start": {
-                                                "line": 95,
-                                                "column": 34
-                                              },
-                                              "end": {
-                                                "line": 95,
-                                                "column": 64
-                                              }
-                                            }
-                                          },
-                                          "decorators": [],
-                                          "loc": {
-                                            "start": {
-                                              "line": 95,
-                                              "column": 26
-                                            },
-                                            "end": {
-                                              "line": 95,
-                                              "column": 31
-                                            }
-                                          }
-                                        },
-                                        "init": null,
-                                        "loc": {
-                                          "start": {
-                                            "line": 95,
-                                            "column": 26
-                                          },
-                                          "end": {
-                                            "line": 95,
-                                            "column": 31
-                                          }
-                                        }
-                                      }
-                                    ],
-                                    "kind": "let",
-                                    "loc": {
-                                      "start": {
-                                        "line": 95,
-                                        "column": 22
-                                      },
-                                      "end": {
-                                        "line": 95,
-                                        "column": 31
-                                      }
-                                    }
-                                  },
-                                  "right": {
-                                    "type": "CallExpression",
-                                    "callee": {
-                                      "type": "MemberExpression",
-                                      "object": {
-                                        "type": "Identifier",
-                                        "name": "table",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 95,
-                                            "column": 65
-                                          },
-                                          "end": {
-                                            "line": 95,
-                                            "column": 70
-                                          }
-                                        }
-                                      },
-                                      "property": {
-                                        "type": "Identifier",
-                                        "name": "entrySet",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 95,
-                                            "column": 71
-                                          },
-                                          "end": {
-                                            "line": 95,
-                                            "column": 79
-                                          }
-                                        }
-                                      },
-                                      "computed": false,
-                                      "optional": false,
-                                      "loc": {
-                                        "start": {
-                                          "line": 95,
-                                          "column": 65
-                                        },
-                                        "end": {
-                                          "line": 95,
-                                          "column": 79
-                                        }
-                                      }
-                                    },
-                                    "arguments": [],
-                                    "optional": false,
-                                    "loc": {
-                                      "start": {
-                                        "line": 95,
-                                        "column": 65
-                                      },
-                                      "end": {
-                                        "line": 95,
-                                        "column": 81
-                                      }
-                                    }
-                                  },
-                                  "body": {
-                                    "type": "BlockStatement",
-                                    "statements": [
-                                      {
-                                        "type": "VariableDeclaration",
-                                        "declarations": [
-                                          {
-                                            "type": "VariableDeclarator",
-                                            "id": {
-                                              "type": "Identifier",
-                                              "name": "c",
-                                              "typeAnnotation": {
-                                                "type": "ETSTypeReference",
-                                                "part": {
-                                                  "type": "ETSTypeReferencePart",
-                                                  "name": {
-                                                    "type": "Identifier",
-                                                    "name": "Char",
-                                                    "decorators": [],
-                                                    "loc": {
-                                                      "start": {
-                                                        "line": 96,
-                                                        "column": 29
-                                                      },
-                                                      "end": {
-                                                        "line": 96,
-                                                        "column": 33
-                                                      }
-                                                    }
-                                                  },
-                                                  "loc": {
-                                                    "start": {
-                                                      "line": 96,
-                                                      "column": 29
-                                                    },
-                                                    "end": {
-                                                      "line": 96,
-                                                      "column": 35
-                                                    }
-                                                  }
-                                                },
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 96,
-                                                    "column": 29
-                                                  },
-                                                  "end": {
-                                                    "line": 96,
-                                                    "column": 35
-                                                  }
-                                                }
-                                              },
-                                              "decorators": [],
-                                              "loc": {
-                                                "start": {
-                                                  "line": 96,
-                                                  "column": 25
-                                                },
-                                                "end": {
-                                                  "line": 96,
-                                                  "column": 26
-                                                }
-                                              }
-                                            },
-                                            "init": {
-                                              "type": "CallExpression",
-                                              "callee": {
-                                                "type": "MemberExpression",
-                                                "object": {
-                                                  "type": "Identifier",
-                                                  "name": "entry",
-                                                  "decorators": [],
-                                                  "loc": {
-                                                    "start": {
-                                                      "line": 96,
-                                                      "column": 36
-                                                    },
-                                                    "end": {
-                                                      "line": 96,
-                                                      "column": 41
-                                                    }
-                                                  }
-                                                },
-                                                "property": {
-                                                  "type": "Identifier",
-                                                  "name": "getKey",
-                                                  "decorators": [],
-                                                  "loc": {
-                                                    "start": {
-                                                      "line": 96,
-                                                      "column": 42
-                                                    },
-                                                    "end": {
-                                                      "line": 96,
-                                                      "column": 48
-                                                    }
-                                                  }
-                                                },
-                                                "computed": false,
-                                                "optional": false,
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 96,
-                                                    "column": 36
-                                                  },
-                                                  "end": {
-                                                    "line": 96,
-                                                    "column": 48
-                                                  }
-                                                }
-                                              },
-                                              "arguments": [],
-                                              "optional": false,
-                                              "loc": {
-                                                "start": {
-                                                  "line": 96,
-                                                  "column": 36
-                                                },
-                                                "end": {
-                                                  "line": 96,
-                                                  "column": 50
-                                                }
-                                              }
-                                            },
-                                            "loc": {
-                                              "start": {
-                                                "line": 96,
-                                                "column": 25
-                                              },
-                                              "end": {
-                                                "line": 96,
-                                                "column": 50
-                                              }
-                                            }
-                                          }
-                                        ],
-                                        "kind": "let",
-                                        "loc": {
-                                          "start": {
-                                            "line": 96,
-                                            "column": 21
-                                          },
-                                          "end": {
-                                            "line": 96,
-                                            "column": 51
-                                          }
-                                        }
-                                      },
-                                      {
-                                        "type": "IfStatement",
-                                        "test": {
-                                          "type": "BinaryExpression",
-                                          "operator": "<",
-                                          "left": {
-                                            "type": "Identifier",
-                                            "name": "r",
-                                            "decorators": [],
-                                            "loc": {
-                                              "start": {
-                                                "line": 97,
-                                                "column": 25
-                                              },
-                                              "end": {
-                                                "line": 97,
-                                                "column": 26
-                                              }
-                                            }
-                                          },
-                                          "right": {
-                                            "type": "CallExpression",
-                                            "callee": {
-                                              "type": "MemberExpression",
-                                              "object": {
-                                                "type": "Identifier",
-                                                "name": "entry",
-                                                "decorators": [],
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 97,
-                                                    "column": 29
-                                                  },
-                                                  "end": {
-                                                    "line": 97,
-                                                    "column": 34
-                                                  }
-                                                }
-                                              },
-                                              "property": {
-                                                "type": "Identifier",
-                                                "name": "getValue",
-                                                "decorators": [],
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 97,
-                                                    "column": 35
-                                                  },
-                                                  "end": {
-                                                    "line": 97,
-                                                    "column": 43
-                                                  }
-                                                }
-                                              },
-                                              "computed": false,
-                                              "optional": false,
-                                              "loc": {
-                                                "start": {
-                                                  "line": 97,
-                                                  "column": 29
-                                                },
-                                                "end": {
-                                                  "line": 97,
-                                                  "column": 43
-                                                }
-                                              }
-                                            },
-                                            "arguments": [],
-                                            "optional": false,
-                                            "loc": {
-                                              "start": {
-                                                "line": 97,
-                                                "column": 29
-                                              },
-                                              "end": {
-                                                "line": 97,
-                                                "column": 45
-                                              }
-                                            }
-                                          },
-                                          "loc": {
-                                            "start": {
-                                              "line": 97,
-                                              "column": 25
-                                            },
-                                            "end": {
-                                              "line": 97,
-                                              "column": 45
-                                            }
-                                          }
-                                        },
-                                        "consequent": {
-                                          "type": "BlockStatement",
-                                          "statements": [
-                                            {
-                                              "type": "ExpressionStatement",
-                                              "expression": {
-                                                "type": "AssignmentExpression",
-                                                "operator": "=",
-                                                "left": {
-                                                  "type": "MemberExpression",
-                                                  "object": {
-                                                    "type": "Identifier",
-                                                    "name": "line",
-                                                    "decorators": [],
-                                                    "loc": {
-                                                      "start": {
-                                                        "line": 98,
-                                                        "column": 25
-                                                      },
-                                                      "end": {
-                                                        "line": 98,
-                                                        "column": 29
-                                                      }
-                                                    }
-                                                  },
-                                                  "property": {
-                                                    "type": "Identifier",
-                                                    "name": "i",
-                                                    "decorators": [],
-                                                    "loc": {
-                                                      "start": {
-                                                        "line": 98,
-                                                        "column": 30
-                                                      },
-                                                      "end": {
-                                                        "line": 98,
-                                                        "column": 31
-                                                      }
-                                                    }
-                                                  },
-                                                  "computed": true,
-                                                  "optional": false,
-                                                  "loc": {
-                                                    "start": {
-                                                      "line": 98,
-                                                      "column": 25
-                                                    },
-                                                    "end": {
-                                                      "line": 98,
-                                                      "column": 32
-                                                    }
-                                                  }
-                                                },
-                                                "right": {
-                                                  "type": "Identifier",
-                                                  "name": "c",
-                                                  "decorators": [],
-                                                  "loc": {
-                                                    "start": {
-                                                      "line": 98,
-                                                      "column": 35
-                                                    },
-                                                    "end": {
-                                                      "line": 98,
-                                                      "column": 36
-                                                    }
-                                                  }
-                                                },
-                                                "loc": {
-                                                  "start": {
-                                                    "line": 98,
-                                                    "column": 25
-                                                  },
-                                                  "end": {
-                                                    "line": 98,
-                                                    "column": 36
-                                                  }
-                                                }
-                                              },
-                                              "loc": {
-                                                "start": {
-                                                  "line": 98,
-                                                  "column": 25
-                                                },
-                                                "end": {
-                                                  "line": 98,
-                                                  "column": 37
-                                                }
-                                              }
-                                            },
-                                            {
-                                              "type": "BreakStatement",
-                                              "label": null,
-                                              "loc": {
-                                                "start": {
-                                                  "line": 99,
-                                                  "column": 25
-                                                },
-                                                "end": {
-                                                  "line": 99,
-                                                  "column": 31
-                                                }
-                                              }
-                                            }
-                                          ],
-                                          "loc": {
-                                            "start": {
-                                              "line": 97,
-                                              "column": 47
-                                            },
-                                            "end": {
-                                              "line": 100,
-                                              "column": 22
-                                            }
-                                          }
-                                        },
-                                        "alternate": null,
-                                        "loc": {
-                                          "start": {
-                                            "line": 97,
-                                            "column": 21
-                                          },
-                                          "end": {
-                                            "line": 100,
-                                            "column": 22
-                                          }
-                                        }
-                                      }
-                                    ],
-                                    "loc": {
-                                      "start": {
-                                        "line": 95,
-                                        "column": 82
-                                      },
-                                      "end": {
-                                        "line": 101,
-                                        "column": 18
-                                      }
-                                    }
-                                  },
-                                  "loc": {
-                                    "start": {
-                                      "line": 95,
-                                      "column": 17
-                                    },
-                                    "end": {
-                                      "line": 101,
-                                      "column": 18
-                                    }
-                                  }
-                                }
-                              ],
-                              "loc": {
-                                "start": {
-                                  "line": 93,
-                                  "column": 57
-                                },
-                                "end": {
-                                  "line": 102,
-                                  "column": 14
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 93,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 102,
-                                "column": 14
-                              }
-                            }
-                          },
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "AssignmentExpression",
-                              "operator": "+=",
-                              "left": {
-                                "type": "Identifier",
-                                "name": "ret",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 103,
-                                    "column": 13
-                                  },
-                                  "end": {
-                                    "line": 103,
-                                    "column": 16
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "CallExpression",
-                                "callee": {
-                                  "type": "MemberExpression",
-                                  "object": {
-                                    "type": "ETSNewClassInstanceExpression",
-                                    "typeReference": {
-                                      "type": "ETSTypeReference",
-                                      "part": {
-                                        "type": "ETSTypeReferencePart",
-                                        "name": {
-                                          "type": "Identifier",
-                                          "name": "String",
-                                          "decorators": [],
-                                          "loc": {
-                                            "start": {
-                                              "line": 103,
-                                              "column": 24
-                                            },
-                                            "end": {
-                                              "line": 103,
-                                              "column": 30
-                                            }
-                                          }
-                                        },
-                                        "loc": {
-                                          "start": {
-                                            "line": 103,
-                                            "column": 24
-                                          },
-                                          "end": {
-                                            "line": 103,
-                                            "column": 31
-                                          }
-                                        }
-                                      },
-                                      "loc": {
-                                        "start": {
-                                          "line": 103,
-                                          "column": 24
-                                        },
-                                        "end": {
-                                          "line": 103,
-                                          "column": 31
-                                        }
-                                      }
-                                    },
-                                    "arguments": [
-                                      {
-                                        "type": "Identifier",
-                                        "name": "line",
-                                        "decorators": [],
-                                        "loc": {
-                                          "start": {
-                                            "line": 103,
-                                            "column": 31
-                                          },
-                                          "end": {
-                                            "line": 103,
-                                            "column": 35
-                                          }
-                                        }
-                                      }
-                                    ],
-                                    "loc": {
-                                      "start": {
-                                        "line": 103,
-                                        "column": 20
-                                      },
-                                      "end": {
-                                        "line": 103,
-                                        "column": 37
-                                      }
-                                    }
-                                  },
-                                  "property": {
-                                    "type": "Identifier",
-                                    "name": "length",
-                                    "decorators": [],
-                                    "loc": {
-                                      "start": {
-                                        "line": 103,
-                                        "column": 37
-                                      },
-                                      "end": {
-                                        "line": 103,
-                                        "column": 43
-                                      }
-                                    }
-                                  },
-                                  "computed": false,
-                                  "optional": false,
-                                  "loc": {
-                                    "start": {
-                                      "line": 103,
-                                      "column": 20
-                                    },
-                                    "end": {
-                                      "line": 103,
-                                      "column": 43
-                                    }
-                                  }
-                                },
-                                "arguments": [],
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 103,
-                                    "column": 20
-                                  },
-                                  "end": {
-                                    "line": 103,
-                                    "column": 45
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 103,
-                                  "column": 13
-                                },
-                                "end": {
-                                  "line": 103,
-                                  "column": 45
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 103,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 103,
-                                "column": 46
-                              }
-                            }
-                          },
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "AssignmentExpression",
-                              "operator": "-=",
-                              "left": {
-                                "type": "Identifier",
-                                "name": "n",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 104,
-                                    "column": 13
-                                  },
-                                  "end": {
-                                    "line": 104,
-                                    "column": 14
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "Identifier",
-                                  "name": "line",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 104,
-                                      "column": 18
-                                    },
-                                    "end": {
-                                      "line": 104,
-                                      "column": 22
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "length",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 104,
-                                      "column": 23
-                                    },
-                                    "end": {
-                                      "line": 104,
-                                      "column": 29
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 104,
-                                    "column": 18
-                                  },
-                                  "end": {
-                                    "line": 104,
-                                    "column": 29
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 104,
-                                  "column": 13
-                                },
-                                "end": {
-                                  "line": 104,
-                                  "column": 29
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 104,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 104,
-                                "column": 30
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 89,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 105,
-                            "column": 10
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 88,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 105,
-                          "column": 10
-                        }
-                      }
-                    },
-                    {
-                      "type": "ReturnStatement",
-                      "argument": {
-                        "type": "Identifier",
-                        "name": "ret",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 106,
-                            "column": 16
-                          },
-                          "end": {
-                            "line": 106,
-                            "column": 19
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 106,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 106,
-                          "column": 20
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 84,
-                      "column": 69
-                    },
-                    "end": {
-                      "line": 107,
-                      "column": 6
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 84,
-                    "column": 23
-                  },
-                  "end": {
-                    "line": 107,
-                    "column": 6
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 84,
-                  "column": 23
-                },
-                "end": {
-                  "line": 107,
-                  "column": 6
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 84,
-                "column": 5
-              },
-              "end": {
-                "line": 107,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "count",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 108,
-                  "column": 5
-                },
-                "end": {
-                  "line": 108,
-                  "column": 10
-                }
-              }
-            },
-            "value": {
-              "type": "NumberLiteral",
-              "value": 7,
-              "loc": {
-                "start": {
-                  "line": 108,
-                  "column": 19
-                },
-                "end": {
-                  "line": 108,
-                  "column": 20
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": false,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSPrimitiveType",
-              "loc": {
-                "start": {
-                  "line": 108,
-                  "column": 13
-                },
-                "end": {
-                  "line": 108,
-                  "column": 16
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "expected",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 109,
-                  "column": 21
-                },
-                "end": {
-                  "line": 109,
-                  "column": 29
-                }
-              }
-            },
-            "value": {
-              "type": "NumberLiteral",
-              "value": 1456000,
-              "loc": {
-                "start": {
-                  "line": 109,
-                  "column": 38
-                },
-                "end": {
-                  "line": 109,
-                  "column": 45
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": true,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSPrimitiveType",
-              "loc": {
-                "start": {
-                  "line": 109,
-                  "column": 32
-                },
-                "end": {
-                  "line": 109,
-                  "column": 35
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "run",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 110,
-                  "column": 17
-                },
-                "end": {
-                  "line": 110,
-                  "column": 20
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "run",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 110,
-                      "column": 17
-                    },
-                    "end": {
-                      "line": 110,
-                      "column": 20
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 110,
-                      "column": 24
-                    },
-                    "end": {
-                      "line": 110,
-                      "column": 28
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [
-                    {
-                      "type": "VariableDeclaration",
-                      "declarations": [
-                        {
-                          "type": "VariableDeclarator",
-                          "id": {
-                            "type": "Identifier",
-                            "name": "ret",
-                            "typeAnnotation": {
-                              "type": "ETSPrimitiveType",
-                              "loc": {
-                                "start": {
-                                  "line": 111,
-                                  "column": 19
-                                },
-                                "end": {
-                                  "line": 111,
-                                  "column": 22
-                                }
-                              }
-                            },
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 111,
-                                "column": 13
-                              },
-                              "end": {
-                                "line": 111,
-                                "column": 16
-                              }
-                            }
-                          },
-                          "init": {
-                            "type": "NumberLiteral",
-                            "value": 0,
-                            "loc": {
-                              "start": {
-                                "line": 111,
-                                "column": 25
-                              },
-                              "end": {
-                                "line": 111,
-                                "column": 26
-                              }
-                            }
-                          },
-                          "loc": {
-                            "start": {
-                              "line": 111,
-                              "column": 13
-                            },
-                            "end": {
-                              "line": 111,
-                              "column": 26
-                            }
-                          }
-                        }
-                      ],
-                      "kind": "let",
-                      "loc": {
-                        "start": {
-                          "line": 111,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 111,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "AssignmentExpression",
-                        "operator": "+=",
-                        "left": {
-                          "type": "Identifier",
-                          "name": "ret",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 112,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 112,
-                              "column": 12
-                            }
-                          }
-                        },
-                        "right": {
-                          "type": "CallExpression",
-                          "callee": {
-                            "type": "Identifier",
-                            "name": "fastaRepeat",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 112,
-                                "column": 16
-                              },
-                              "end": {
-                                "line": 112,
-                                "column": 27
-                              }
-                            }
-                          },
-                          "arguments": [
-                            {
-                              "type": "BinaryExpression",
-                              "operator": "*",
-                              "left": {
-                                "type": "BinaryExpression",
-                                "operator": "*",
-                                "left": {
-                                  "type": "NumberLiteral",
-                                  "value": 2,
-                                  "loc": {
-                                    "start": {
-                                      "line": 112,
-                                      "column": 28
-                                    },
-                                    "end": {
-                                      "line": 112,
-                                      "column": 29
-                                    }
-                                  }
-                                },
-                                "right": {
-                                  "type": "Identifier",
-                                  "name": "count",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 112,
-                                      "column": 32
-                                    },
-                                    "end": {
-                                      "line": 112,
-                                      "column": 37
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 112,
-                                    "column": 28
-                                  },
-                                  "end": {
-                                    "line": 112,
-                                    "column": 37
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "NumberLiteral",
-                                "value": 100000,
-                                "loc": {
-                                  "start": {
-                                    "line": 112,
-                                    "column": 40
-                                  },
-                                  "end": {
-                                    "line": 112,
-                                    "column": 46
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 112,
-                                  "column": 28
-                                },
-                                "end": {
-                                  "line": 112,
-                                  "column": 46
-                                }
-                              }
-                            },
-                            {
-                              "type": "Identifier",
-                              "name": "ALU",
-                              "decorators": [],
-                              "loc": {
-                                "start": {
-                                  "line": 112,
-                                  "column": 48
-                                },
-                                "end": {
-                                  "line": 112,
-                                  "column": 51
-                                }
-                              }
-                            }
-                          ],
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 112,
-                              "column": 16
-                            },
-                            "end": {
-                              "line": 112,
-                              "column": 52
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 112,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 112,
-                            "column": 52
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 112,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 112,
-                          "column": 53
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "AssignmentExpression",
-                        "operator": "+=",
-                        "left": {
-                          "type": "Identifier",
-                          "name": "ret",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 113,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 113,
-                              "column": 12
-                            }
-                          }
-                        },
-                        "right": {
-                          "type": "CallExpression",
-                          "callee": {
-                            "type": "Identifier",
-                            "name": "fastaRandom",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 113,
-                                "column": 16
-                              },
-                              "end": {
-                                "line": 113,
-                                "column": 27
-                              }
-                            }
-                          },
-                          "arguments": [
-                            {
-                              "type": "BinaryExpression",
-                              "operator": "*",
-                              "left": {
-                                "type": "BinaryExpression",
-                                "operator": "*",
-                                "left": {
-                                  "type": "NumberLiteral",
-                                  "value": 3,
-                                  "loc": {
-                                    "start": {
-                                      "line": 113,
-                                      "column": 28
-                                    },
-                                    "end": {
-                                      "line": 113,
-                                      "column": 29
-                                    }
-                                  }
-                                },
-                                "right": {
-                                  "type": "Identifier",
-                                  "name": "count",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 113,
-                                      "column": 32
-                                    },
-                                    "end": {
-                                      "line": 113,
-                                      "column": 37
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 113,
-                                    "column": 28
-                                  },
-                                  "end": {
-                                    "line": 113,
-                                    "column": 37
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "NumberLiteral",
-                                "value": 1000,
-                                "loc": {
-                                  "start": {
-                                    "line": 113,
-                                    "column": 40
-                                  },
-                                  "end": {
-                                    "line": 113,
-                                    "column": 44
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 113,
-                                  "column": 28
-                                },
-                                "end": {
-                                  "line": 113,
-                                  "column": 44
-                                }
-                              }
-                            },
-                            {
-                              "type": "Identifier",
-                              "name": "IUB",
-                              "decorators": [],
-                              "loc": {
-                                "start": {
-                                  "line": 113,
-                                  "column": 46
-                                },
-                                "end": {
-                                  "line": 113,
-                                  "column": 49
-                                }
-                              }
-                            }
-                          ],
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 113,
-                              "column": 16
-                            },
-                            "end": {
-                              "line": 113,
-                              "column": 50
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 113,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 113,
-                            "column": 50
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 113,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 113,
-                          "column": 51
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "AssignmentExpression",
-                        "operator": "+=",
-                        "left": {
-                          "type": "Identifier",
-                          "name": "ret",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 114,
-                              "column": 9
-                            },
-                            "end": {
-                              "line": 114,
-                              "column": 12
-                            }
-                          }
-                        },
-                        "right": {
-                          "type": "CallExpression",
-                          "callee": {
-                            "type": "Identifier",
-                            "name": "fastaRandom",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 114,
-                                "column": 16
-                              },
-                              "end": {
-                                "line": 114,
-                                "column": 27
-                              }
-                            }
-                          },
-                          "arguments": [
-                            {
-                              "type": "BinaryExpression",
-                              "operator": "*",
-                              "left": {
-                                "type": "BinaryExpression",
-                                "operator": "*",
-                                "left": {
-                                  "type": "NumberLiteral",
-                                  "value": 5,
-                                  "loc": {
-                                    "start": {
-                                      "line": 114,
-                                      "column": 28
-                                    },
-                                    "end": {
-                                      "line": 114,
-                                      "column": 29
-                                    }
-                                  }
-                                },
-                                "right": {
-                                  "type": "Identifier",
-                                  "name": "count",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 114,
-                                      "column": 32
-                                    },
-                                    "end": {
-                                      "line": 114,
-                                      "column": 37
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 114,
-                                    "column": 28
-                                  },
-                                  "end": {
-                                    "line": 114,
-                                    "column": 37
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "NumberLiteral",
-                                "value": 1000,
-                                "loc": {
-                                  "start": {
-                                    "line": 114,
-                                    "column": 40
-                                  },
-                                  "end": {
-                                    "line": 114,
-                                    "column": 44
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 114,
-                                  "column": 28
-                                },
-                                "end": {
-                                  "line": 114,
-                                  "column": 44
-                                }
-                              }
-                            },
-                            {
-                              "type": "Identifier",
-                              "name": "HomoSap",
-                              "decorators": [],
-                              "loc": {
-                                "start": {
-                                  "line": 114,
-                                  "column": 46
-                                },
-                                "end": {
-                                  "line": 114,
-                                  "column": 53
-                                }
-                              }
-                            }
-                          ],
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 114,
-                              "column": 16
-                            },
-                            "end": {
-                              "line": 114,
-                              "column": 54
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 114,
-                            "column": 9
-                          },
-                          "end": {
-                            "line": 114,
-                            "column": 54
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 114,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 114,
-                          "column": 55
-                        }
-                      }
-                    },
-                    {
-                      "type": "AssertStatement",
-                      "test": {
-                        "type": "BinaryExpression",
-                        "operator": "==",
-                        "left": {
-                          "type": "Identifier",
-                          "name": "ret",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 116,
-                              "column": 16
-                            },
-                            "end": {
-                              "line": 116,
-                              "column": 19
-                            }
-                          }
-                        },
-                        "right": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "ThisExpression",
-                            "loc": {
-                              "start": {
-                                "line": 116,
-                                "column": 23
-                              },
-                              "end": {
-                                "line": 116,
-                                "column": 27
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "expected",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 116,
-                                "column": 28
-                              },
-                              "end": {
-                                "line": 116,
-                                "column": 36
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 116,
-                              "column": 23
-                            },
-                            "end": {
-                              "line": 116,
-                              "column": 36
-                            }
-                          }
-                        },
-                        "loc": {
-                          "start": {
-                            "line": 116,
-                            "column": 16
-                          },
-                          "end": {
-                            "line": 116,
-                            "column": 36
-                          }
-                        }
-                      },
-                      "second": {
-                        "type": "StringLiteral",
-                        "value": "Incorrect result",
-                        "loc": {
-                          "start": {
-                            "line": 116,
-                            "column": 38
-                          },
-                          "end": {
-                            "line": 116,
-                            "column": 56
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 116,
-                          "column": 9
-                        },
-                        "end": {
-                          "line": 116,
-                          "column": 57
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 110,
-                      "column": 29
-                    },
-                    "end": {
-                      "line": 117,
-                      "column": 6
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 110,
-                    "column": 20
-                  },
-                  "end": {
-                    "line": 117,
-                    "column": 6
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 110,
-                  "column": 20
-                },
-                "end": {
-                  "line": 117,
-                  "column": 6
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 110,
-                "column": 5
-              },
-              "end": {
-                "line": 117,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 118,
-                "column": 2
-              },
-              "end": {
-                "line": 118,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 16,
-            "column": 32
-          },
-          "end": {
-            "line": 118,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 16,
-          "column": 13
-        },
-        "end": {
-          "line": 118,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "main",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 120,
-                  "column": 10
-                },
-                "end": {
-                  "line": 120,
-                  "column": 14
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": true,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "main",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 120,
-                      "column": 10
-                    },
-                    "end": {
-                      "line": 120,
-                      "column": 14
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "returnType": {
-                  "type": "ETSPrimitiveType",
-                  "loc": {
-                    "start": {
-                      "line": 120,
-                      "column": 18
-                    },
-                    "end": {
-                      "line": 120,
-                      "column": 22
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [
-                    {
-                      "type": "VariableDeclaration",
-                      "declarations": [
-                        {
-                          "type": "VariableDeclarator",
-                          "id": {
-                            "type": "Identifier",
-                            "name": "a",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 121,
-                                "column": 7
-                              },
-                              "end": {
-                                "line": 121,
-                                "column": 8
-                              }
-                            }
-                          },
-                          "init": {
-                            "type": "ETSNewClassInstanceExpression",
-                            "typeReference": {
-                              "type": "ETSTypeReference",
-                              "part": {
-                                "type": "ETSTypeReferencePart",
-                                "name": {
-                                  "type": "Identifier",
-                                  "name": "StringFasta",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 121,
-                                      "column": 15
-                                    },
-                                    "end": {
-                                      "line": 121,
-                                      "column": 26
-                                    }
-                                  }
-                                },
-                                "loc": {
-                                  "start": {
-                                    "line": 121,
-                                    "column": 15
-                                  },
-                                  "end": {
-                                    "line": 121,
-                                    "column": 27
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 121,
-                                  "column": 15
-                                },
-                                "end": {
-                                  "line": 121,
-                                  "column": 27
-                                }
-                              }
-                            },
-                            "arguments": [],
-                            "loc": {
-                              "start": {
-                                "line": 121,
-                                "column": 11
-                              },
-                              "end": {
-                                "line": 121,
-                                "column": 27
-                              }
-                            }
-                          },
-                          "loc": {
-                            "start": {
-                              "line": 121,
-                              "column": 7
-                            },
-                            "end": {
-                              "line": 121,
-                              "column": 27
-                            }
-                          }
-                        }
-                      ],
-                      "kind": "let",
-                      "loc": {
-                        "start": {
-                          "line": 121,
-                          "column": 3
-                        },
-                        "end": {
-                          "line": 121,
-                          "column": 27
-                        }
-                      }
-                    },
-                    {
-                      "type": "ExpressionStatement",
-                      "expression": {
-                        "type": "CallExpression",
-                        "callee": {
-                          "type": "MemberExpression",
-                          "object": {
-                            "type": "Identifier",
-                            "name": "a",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 122,
-                                "column": 3
-                              },
-                              "end": {
-                                "line": 122,
-                                "column": 4
-                              }
-                            }
-                          },
-                          "property": {
-                            "type": "Identifier",
-                            "name": "run",
-                            "decorators": [],
-                            "loc": {
-                              "start": {
-                                "line": 122,
-                                "column": 5
-                              },
-                              "end": {
-                                "line": 122,
-                                "column": 8
-                              }
-                            }
-                          },
-                          "computed": false,
-                          "optional": false,
-                          "loc": {
-                            "start": {
-                              "line": 122,
-                              "column": 3
-                            },
-                            "end": {
-                              "line": 122,
-                              "column": 8
-                            }
-                          }
-                        },
-                        "arguments": [],
-                        "optional": false,
-                        "loc": {
-                          "start": {
-                            "line": 122,
-                            "column": 3
-                          },
-                          "end": {
-                            "line": 122,
-                            "column": 10
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 122,
-                          "column": 3
-                        },
-                        "end": {
-                          "line": 122,
-                          "column": 11
-                        }
-                      }
-                    }
-                  ],
-                  "loc": {
-                    "start": {
-                      "line": 120,
-                      "column": 23
-                    },
-                    "end": {
-                      "line": 123,
-                      "column": 2
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 120,
-                    "column": 14
-                  },
-                  "end": {
-                    "line": 123,
-                    "column": 2
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 120,
-                  "column": 14
-                },
-                "end": {
-                  "line": 123,
-                  "column": 2
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 120,
-                "column": 1
-              },
-              "end": {
-                "line": 123,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 124,
-      "column": 1
-    }
-  }
-}
-SyntaxError: Cannot find type 'HashMap'. [StringFasta.ets:18:46]
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [StringFasta.ets:41:12]
diff --git a/ets2panda/test/parser/ets/class_interface_enum_only_top_level_4-expected.txt b/ets2panda/test/parser/ets/class_interface_enum_only_top_level_4-expected.txt
index 5c83602e3c..5445391d65 100644
--- a/ets2panda/test/parser/ets/class_interface_enum_only_top_level_4-expected.txt
+++ b/ets2panda/test/parser/ets/class_interface_enum_only_top_level_4-expected.txt
@@ -1 +1,469 @@
-SyntaxError: Local interface declaration support is not yet implemented. [class_interface_enum_only_top_level_4.ets:18:3]
+{
+  "type": "Program",
+  "statements": [
+    {
+      "type": "ClassDeclaration",
+      "definition": {
+        "id": {
+          "type": "Identifier",
+          "name": "ETSGLOBAL",
+          "decorators": [],
+          "loc": {
+            "start": {
+              "line": 1,
+              "column": 1
+            },
+            "end": {
+              "line": 1,
+              "column": 1
+            }
+          }
+        },
+        "superClass": null,
+        "implements": [],
+        "body": [
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "_$init$_",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "_$init$_",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 1,
+                    "column": 1
+                  },
+                  "end": {
+                    "line": 1,
+                    "column": 1
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 1,
+                "column": 1
+              },
+              "end": {
+                "line": 1,
+                "column": 1
+              }
+            }
+          },
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "main",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 16,
+                  "column": 10
+                },
+                "end": {
+                  "line": 16,
+                  "column": 14
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "main",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 16,
+                      "column": 10
+                    },
+                    "end": {
+                      "line": 16,
+                      "column": 14
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "returnType": {
+                  "type": "ETSTypeReference",
+                  "part": {
+                    "type": "ETSTypeReferencePart",
+                    "name": {
+                      "type": "Identifier",
+                      "name": "void",
+                      "decorators": [],
+                      "loc": {
+                        "start": {
+                          "line": 16,
+                          "column": 19
+                        },
+                        "end": {
+                          "line": 16,
+                          "column": 23
+                        }
+                      }
+                    },
+                    "loc": {
+                      "start": {
+                        "line": 16,
+                        "column": 19
+                      },
+                      "end": {
+                        "line": 17,
+                        "column": 2
+                      }
+                    }
+                  },
+                  "loc": {
+                    "start": {
+                      "line": 16,
+                      "column": 19
+                    },
+                    "end": {
+                      "line": 17,
+                      "column": 2
+                    }
+                  }
+                },
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [
+                    {
+                      "type": "TSInterfaceDeclaration",
+                      "body": {
+                        "type": "TSInterfaceBody",
+                        "body": [
+                          {
+                            "type": "MethodDefinition",
+                            "key": {
+                              "type": "Identifier",
+                              "name": "foo",
+                              "decorators": [],
+                              "loc": {
+                                "start": {
+                                  "line": 19,
+                                  "column": 5
+                                },
+                                "end": {
+                                  "line": 19,
+                                  "column": 8
+                                }
+                              }
+                            },
+                            "kind": "method",
+                            "accessibility": "public",
+                            "static": false,
+                            "optional": false,
+                            "computed": false,
+                            "value": {
+                              "type": "FunctionExpression",
+                              "function": {
+                                "type": "ScriptFunction",
+                                "id": {
+                                  "type": "Identifier",
+                                  "name": "foo",
+                                  "decorators": [],
+                                  "loc": {
+                                    "start": {
+                                      "line": 19,
+                                      "column": 5
+                                    },
+                                    "end": {
+                                      "line": 19,
+                                      "column": 8
+                                    }
+                                  }
+                                },
+                                "generator": false,
+                                "async": false,
+                                "expression": false,
+                                "params": [
+                                  {
+                                    "type": "ETSParameterExpression",
+                                    "name": {
+                                      "type": "Identifier",
+                                      "name": "a",
+                                      "typeAnnotation": {
+                                        "type": "ETSPrimitiveType",
+                                        "loc": {
+                                          "start": {
+                                            "line": 19,
+                                            "column": 12
+                                          },
+                                          "end": {
+                                            "line": 19,
+                                            "column": 15
+                                          }
+                                        }
+                                      },
+                                      "decorators": [],
+                                      "loc": {
+                                        "start": {
+                                          "line": 19,
+                                          "column": 9
+                                        },
+                                        "end": {
+                                          "line": 19,
+                                          "column": 15
+                                        }
+                                      }
+                                    },
+                                    "loc": {
+                                      "start": {
+                                        "line": 19,
+                                        "column": 9
+                                      },
+                                      "end": {
+                                        "line": 19,
+                                        "column": 15
+                                      }
+                                    }
+                                  }
+                                ],
+                                "returnType": {
+                                  "type": "ETSPrimitiveType",
+                                  "loc": {
+                                    "start": {
+                                      "line": 19,
+                                      "column": 18
+                                    },
+                                    "end": {
+                                      "line": 19,
+                                      "column": 21
+                                    }
+                                  }
+                                },
+                                "declare": true,
+                                "loc": {
+                                  "start": {
+                                    "line": 19,
+                                    "column": 8
+                                  },
+                                  "end": {
+                                    "line": 19,
+                                    "column": 21
+                                  }
+                                }
+                              },
+                              "loc": {
+                                "start": {
+                                  "line": 19,
+                                  "column": 8
+                                },
+                                "end": {
+                                  "line": 19,
+                                  "column": 21
+                                }
+                              }
+                            },
+                            "overloads": [],
+                            "decorators": [],
+                            "loc": {
+                              "start": {
+                                "line": 19,
+                                "column": 5
+                              },
+                              "end": {
+                                "line": 19,
+                                "column": 22
+                              }
+                            }
+                          }
+                        ],
+                        "loc": {
+                          "start": {
+                            "line": 18,
+                            "column": 15
+                          },
+                          "end": {
+                            "line": 20,
+                            "column": 4
+                          }
+                        }
+                      },
+                      "id": {
+                        "type": "Identifier",
+                        "name": "C",
+                        "decorators": [],
+                        "loc": {
+                          "start": {
+                            "line": 18,
+                            "column": 13
+                          },
+                          "end": {
+                            "line": 18,
+                            "column": 14
+                          }
+                        }
+                      },
+                      "extends": [],
+                      "loc": {
+                        "start": {
+                          "line": 18,
+                          "column": 3
+                        },
+                        "end": {
+                          "line": 21,
+                          "column": 2
+                        }
+                      }
+                    }
+                  ],
+                  "loc": {
+                    "start": {
+                      "line": 17,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 21,
+                      "column": 2
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 16,
+                    "column": 14
+                  },
+                  "end": {
+                    "line": 21,
+                    "column": 2
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 16,
+                  "column": 14
+                },
+                "end": {
+                  "line": 21,
+                  "column": 2
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 16,
+                "column": 1
+              },
+              "end": {
+                "line": 21,
+                "column": 2
+              }
+            }
+          }
+        ],
+        "loc": {
+          "start": {
+            "line": 1,
+            "column": 1
+          },
+          "end": {
+            "line": 1,
+            "column": 1
+          }
+        }
+      },
+      "loc": {
+        "start": {
+          "line": 1,
+          "column": 1
+        },
+        "end": {
+          "line": 1,
+          "column": 1
+        }
+      }
+    }
+  ],
+  "loc": {
+    "start": {
+      "line": 1,
+      "column": 1
+    },
+    "end": {
+      "line": 22,
+      "column": 1
+    }
+  }
+}
diff --git a/ets2panda/test/parser/ets/class_property_access-expected.txt b/ets2panda/test/parser/ets/class_property_access-expected.txt
index b10c7fcfb9..0d95692993 100644
--- a/ets2panda/test/parser/ets/class_property_access-expected.txt
+++ b/ets2panda/test/parser/ets/class_property_access-expected.txt
@@ -1,785 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "outer",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 16,
-              "column": 7
-            },
-            "end": {
-              "line": 16,
-              "column": 12
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "foo",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 17,
-                  "column": 10
-                },
-                "end": {
-                  "line": 17,
-                  "column": 13
-                }
-              }
-            },
-            "value": {
-              "type": "NumberLiteral",
-              "value": 1,
-              "loc": {
-                "start": {
-                  "line": 17,
-                  "column": 24
-                },
-                "end": {
-                  "line": 17,
-                  "column": 27
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": true,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSPrimitiveType",
-              "loc": {
-                "start": {
-                  "line": 17,
-                  "column": 15
-                },
-                "end": {
-                  "line": 17,
-                  "column": 21
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "inner",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 18,
-                    "column": 9
-                  },
-                  "end": {
-                    "line": 18,
-                    "column": 14
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "getFoo",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 19,
-                        "column": 5
-                      },
-                      "end": {
-                        "line": 19,
-                        "column": 11
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "getFoo",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 19,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 19,
-                            "column": 11
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 19,
-                            "column": 15
-                          },
-                          "end": {
-                            "line": 19,
-                            "column": 21
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "ReturnStatement",
-                            "argument": {
-                              "type": "MemberExpression",
-                              "object": {
-                                "type": "Identifier",
-                                "name": "outer",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 20,
-                                    "column": 16
-                                  },
-                                  "end": {
-                                    "line": 20,
-                                    "column": 21
-                                  }
-                                }
-                              },
-                              "property": {
-                                "type": "Identifier",
-                                "name": "foo",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 20,
-                                    "column": 22
-                                  },
-                                  "end": {
-                                    "line": 20,
-                                    "column": 25
-                                  }
-                                }
-                              },
-                              "computed": false,
-                              "optional": false,
-                              "loc": {
-                                "start": {
-                                  "line": 20,
-                                  "column": 16
-                                },
-                                "end": {
-                                  "line": 20,
-                                  "column": 25
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 20,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 20,
-                                "column": 26
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 19,
-                            "column": 22
-                          },
-                          "end": {
-                            "line": 21,
-                            "column": 6
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 19,
-                          "column": 11
-                        },
-                        "end": {
-                          "line": 21,
-                          "column": 6
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 19,
-                        "column": 11
-                      },
-                      "end": {
-                        "line": 21,
-                        "column": 6
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 19,
-                      "column": 5
-                    },
-                    "end": {
-                      "line": 21,
-                      "column": 6
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "setFoo",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 22,
-                        "column": 5
-                      },
-                      "end": {
-                        "line": 22,
-                        "column": 11
-                      }
-                    }
-                  },
-                  "kind": "method",
-                  "accessibility": "public",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "setFoo",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 22,
-                            "column": 5
-                          },
-                          "end": {
-                            "line": 22,
-                            "column": 11
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [
-                        {
-                          "type": "Identifier",
-                          "name": "arg",
-                          "typeAnnotation": {
-                            "type": "ETSPrimitiveType",
-                            "loc": {
-                              "start": {
-                                "line": 22,
-                                "column": 17
-                              },
-                              "end": {
-                                "line": 22,
-                                "column": 23
-                              }
-                            }
-                          },
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 22,
-                              "column": 12
-                            },
-                            "end": {
-                              "line": 22,
-                              "column": 23
-                            }
-                          }
-                        }
-                      ],
-                      "returnType": {
-                        "type": "ETSPrimitiveType",
-                        "loc": {
-                          "start": {
-                            "line": 22,
-                            "column": 26
-                          },
-                          "end": {
-                            "line": 22,
-                            "column": 30
-                          }
-                        }
-                      },
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [
-                          {
-                            "type": "ExpressionStatement",
-                            "expression": {
-                              "type": "AssignmentExpression",
-                              "operator": "=",
-                              "left": {
-                                "type": "MemberExpression",
-                                "object": {
-                                  "type": "Identifier",
-                                  "name": "outer",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 23,
-                                      "column": 9
-                                    },
-                                    "end": {
-                                      "line": 23,
-                                      "column": 14
-                                    }
-                                  }
-                                },
-                                "property": {
-                                  "type": "Identifier",
-                                  "name": "foo",
-                                  "decorators": [],
-                                  "loc": {
-                                    "start": {
-                                      "line": 23,
-                                      "column": 15
-                                    },
-                                    "end": {
-                                      "line": 23,
-                                      "column": 18
-                                    }
-                                  }
-                                },
-                                "computed": false,
-                                "optional": false,
-                                "loc": {
-                                  "start": {
-                                    "line": 23,
-                                    "column": 9
-                                  },
-                                  "end": {
-                                    "line": 23,
-                                    "column": 18
-                                  }
-                                }
-                              },
-                              "right": {
-                                "type": "Identifier",
-                                "name": "arg",
-                                "decorators": [],
-                                "loc": {
-                                  "start": {
-                                    "line": 23,
-                                    "column": 21
-                                  },
-                                  "end": {
-                                    "line": 23,
-                                    "column": 24
-                                  }
-                                }
-                              },
-                              "loc": {
-                                "start": {
-                                  "line": 23,
-                                  "column": 9
-                                },
-                                "end": {
-                                  "line": 23,
-                                  "column": 24
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 23,
-                                "column": 9
-                              },
-                              "end": {
-                                "line": 23,
-                                "column": 25
-                              }
-                            }
-                          }
-                        ],
-                        "loc": {
-                          "start": {
-                            "line": 22,
-                            "column": 31
-                          },
-                          "end": {
-                            "line": 24,
-                            "column": 6
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 22,
-                          "column": 11
-                        },
-                        "end": {
-                          "line": 24,
-                          "column": 6
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 22,
-                        "column": 11
-                      },
-                      "end": {
-                        "line": 24,
-                        "column": 6
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 22,
-                      "column": 5
-                    },
-                    "end": {
-                      "line": 24,
-                      "column": 6
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 25,
-                      "column": 4
-                    },
-                    "end": {
-                      "line": 25,
-                      "column": 4
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 18,
-                  "column": 15
-                },
-                "end": {
-                  "line": 25,
-                  "column": 4
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 18,
-                "column": 3
-              },
-              "end": {
-                "line": 25,
-                "column": 4
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 26,
-                "column": 2
-              },
-              "end": {
-                "line": 26,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 16,
-            "column": 13
-          },
-          "end": {
-            "line": 26,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 16,
-          "column": 1
-        },
-        "end": {
-          "line": 26,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 27,
-      "column": 1
-    }
-  }
-}
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [class_property_access.ets:18:3]
diff --git a/ets2panda/test/parser/ets/declare_iface-expected.txt b/ets2panda/test/parser/ets/declare_iface-expected.txt
index db0f6ba96b..8f7f8206d4 100644
--- a/ets2panda/test/parser/ets/declare_iface-expected.txt
+++ b/ets2panda/test/parser/ets/declare_iface-expected.txt
@@ -32,23 +32,23 @@
                   },
                   "loc": {
                     "start": {
-                      "line": 17,
-                      "column": 9
+                      "line": 1,
+                      "column": 1
                     },
                     "end": {
-                      "line": 17,
-                      "column": 16
+                      "line": 1,
+                      "column": 1
                     }
                   }
                 },
                 "loc": {
                   "start": {
-                    "line": 17,
-                    "column": 9
+                    "line": 1,
+                    "column": 1
                   },
                   "end": {
-                    "line": 17,
-                    "column": 16
+                    "line": 1,
+                    "column": 1
                   }
                 }
               },
@@ -97,23 +97,23 @@
                       },
                       "loc": {
                         "start": {
-                          "line": 17,
-                          "column": 9
+                          "line": 1,
+                          "column": 1
                         },
                         "end": {
-                          "line": 17,
-                          "column": 16
+                          "line": 1,
+                          "column": 1
                         }
                       }
                     },
                     "loc": {
                       "start": {
-                        "line": 17,
-                        "column": 9
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 17,
-                        "column": 16
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -224,23 +224,23 @@
                       },
                       "loc": {
                         "start": {
-                          "line": 17,
-                          "column": 9
+                          "line": 1,
+                          "column": 1
                         },
                         "end": {
-                          "line": 17,
-                          "column": 16
+                          "line": 1,
+                          "column": 1
                         }
                       }
                     },
                     "loc": {
                       "start": {
-                        "line": 17,
-                        "column": 9
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 17,
-                        "column": 16
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -289,23 +289,23 @@
                           },
                           "loc": {
                             "start": {
-                              "line": 17,
-                              "column": 9
+                              "line": 1,
+                              "column": 1
                             },
                             "end": {
-                              "line": 17,
-                              "column": 16
+                              "line": 1,
+                              "column": 1
                             }
                           }
                         },
                         "loc": {
                           "start": {
-                            "line": 17,
-                            "column": 9
+                            "line": 1,
+                            "column": 1
                           },
                           "end": {
-                            "line": 17,
-                            "column": 16
+                            "line": 1,
+                            "column": 1
                           }
                         }
                       },
@@ -351,23 +351,23 @@
                               },
                               "loc": {
                                 "start": {
-                                  "line": 17,
-                                  "column": 9
+                                  "line": 1,
+                                  "column": 1
                                 },
                                 "end": {
-                                  "line": 17,
-                                  "column": 16
+                                  "line": 1,
+                                  "column": 1
                                 }
                               }
                             },
                             "loc": {
                               "start": {
-                                "line": 17,
-                                "column": 9
+                                "line": 1,
+                                "column": 1
                               },
                               "end": {
-                                "line": 17,
-                                "column": 16
+                                "line": 1,
+                                "column": 1
                               }
                             }
                           },
@@ -470,23 +470,23 @@
                   },
                   "loc": {
                     "start": {
-                      "line": 17,
-                      "column": 9
+                      "line": 1,
+                      "column": 1
                     },
                     "end": {
-                      "line": 17,
-                      "column": 16
+                      "line": 1,
+                      "column": 1
                     }
                   }
                 },
                 "loc": {
                   "start": {
-                    "line": 17,
-                    "column": 9
+                    "line": 1,
+                    "column": 1
                   },
                   "end": {
-                    "line": 17,
-                    "column": 16
+                    "line": 1,
+                    "column": 1
                   }
                 }
               },
@@ -535,23 +535,23 @@
                       },
                       "loc": {
                         "start": {
-                          "line": 17,
-                          "column": 9
+                          "line": 1,
+                          "column": 1
                         },
                         "end": {
-                          "line": 17,
-                          "column": 16
+                          "line": 1,
+                          "column": 1
                         }
                       }
                     },
                     "loc": {
                       "start": {
-                        "line": 17,
-                        "column": 9
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 17,
-                        "column": 16
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -597,23 +597,23 @@
                           },
                           "loc": {
                             "start": {
-                              "line": 17,
-                              "column": 9
+                              "line": 1,
+                              "column": 1
                             },
                             "end": {
-                              "line": 17,
-                              "column": 16
+                              "line": 1,
+                              "column": 1
                             }
                           }
                         },
                         "loc": {
                           "start": {
-                            "line": 17,
-                            "column": 9
+                            "line": 1,
+                            "column": 1
                           },
                           "end": {
-                            "line": 17,
-                            "column": 16
+                            "line": 1,
+                            "column": 1
                           }
                         }
                       },
diff --git a/ets2panda/test/parser/ets/import_tests/import_recursive-expected.txt b/ets2panda/test/parser/ets/import_tests/import_recursive-expected.txt
index 8d3a68b63a..737a20a76e 100755
--- a/ets2panda/test/parser/ets/import_tests/import_recursive-expected.txt
+++ b/ets2panda/test/parser/ets/import_tests/import_recursive-expected.txt
@@ -1 +1,210 @@
-SyntaxError: Recursive import not allowed [subpackage_module_1.ets:18:1]
+{
+  "type": "Program",
+  "statements": [
+    {
+      "type": "ImportDeclaration",
+      "source": {
+        "type": "StringLiteral",
+        "value": "import_tests/packages/recursive",
+        "loc": {
+          "start": {
+            "line": 16,
+            "column": 15
+          },
+          "end": {
+            "line": 16,
+            "column": 48
+          }
+        }
+      },
+      "specifiers": [
+        {
+          "type": "ImportNamespaceSpecifier",
+          "local": {
+            "type": "Identifier",
+            "name": "",
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 1,
+                "column": 1
+              },
+              "end": {
+                "line": 1,
+                "column": 1
+              }
+            }
+          },
+          "loc": {
+            "start": {
+              "line": 16,
+              "column": 8
+            },
+            "end": {
+              "line": 16,
+              "column": 14
+            }
+          }
+        }
+      ],
+      "loc": {
+        "start": {
+          "line": 16,
+          "column": 1
+        },
+        "end": {
+          "line": 16,
+          "column": 49
+        }
+      }
+    },
+    {
+      "type": "ClassDeclaration",
+      "definition": {
+        "id": {
+          "type": "Identifier",
+          "name": "ETSGLOBAL",
+          "decorators": [],
+          "loc": {
+            "start": {
+              "line": 1,
+              "column": 1
+            },
+            "end": {
+              "line": 1,
+              "column": 1
+            }
+          }
+        },
+        "superClass": null,
+        "implements": [],
+        "body": [
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "_$init$_",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "_$init$_",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 1,
+                    "column": 1
+                  },
+                  "end": {
+                    "line": 1,
+                    "column": 1
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 1,
+                "column": 1
+              },
+              "end": {
+                "line": 1,
+                "column": 1
+              }
+            }
+          }
+        ],
+        "loc": {
+          "start": {
+            "line": 1,
+            "column": 1
+          },
+          "end": {
+            "line": 1,
+            "column": 1
+          }
+        }
+      },
+      "loc": {
+        "start": {
+          "line": 1,
+          "column": 1
+        },
+        "end": {
+          "line": 1,
+          "column": 1
+        }
+      }
+    }
+  ],
+  "loc": {
+    "start": {
+      "line": 1,
+      "column": 1
+    },
+    "end": {
+      "line": 17,
+      "column": 1
+    }
+  }
+}
diff --git a/ets2panda/test/parser/ets/import_tests/packages/recursive/subpackage/subpackage_module_1-expected.txt b/ets2panda/test/parser/ets/import_tests/packages/recursive/subpackage/subpackage_module_1-expected.txt
index 8d3a68b63a..700e1ee2c7 100755
--- a/ets2panda/test/parser/ets/import_tests/packages/recursive/subpackage/subpackage_module_1-expected.txt
+++ b/ets2panda/test/parser/ets/import_tests/packages/recursive/subpackage/subpackage_module_1-expected.txt
@@ -1 +1,319 @@
-SyntaxError: Recursive import not allowed [subpackage_module_1.ets:18:1]
+{
+  "type": "Program",
+  "statements": [
+    {
+      "type": "ETSPackageDeclaration",
+      "name": {
+        "type": "TSQualifiedName",
+        "left": {
+          "type": "TSQualifiedName",
+          "left": {
+            "type": "TSQualifiedName",
+            "left": {
+              "type": "Identifier",
+              "name": "import_tests",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 16,
+                  "column": 9
+                },
+                "end": {
+                  "line": 16,
+                  "column": 21
+                }
+              }
+            },
+            "right": {
+              "type": "Identifier",
+              "name": "packages",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 16,
+                  "column": 22
+                },
+                "end": {
+                  "line": 16,
+                  "column": 30
+                }
+              }
+            },
+            "loc": {
+              "start": {
+                "line": 16,
+                "column": 9
+              },
+              "end": {
+                "line": 16,
+                "column": 30
+              }
+            }
+          },
+          "right": {
+            "type": "Identifier",
+            "name": "recursive",
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 16,
+                "column": 31
+              },
+              "end": {
+                "line": 16,
+                "column": 40
+              }
+            }
+          },
+          "loc": {
+            "start": {
+              "line": 16,
+              "column": 9
+            },
+            "end": {
+              "line": 16,
+              "column": 40
+            }
+          }
+        },
+        "right": {
+          "type": "Identifier",
+          "name": "subpackage",
+          "decorators": [],
+          "loc": {
+            "start": {
+              "line": 16,
+              "column": 41
+            },
+            "end": {
+              "line": 16,
+              "column": 51
+            }
+          }
+        },
+        "loc": {
+          "start": {
+            "line": 16,
+            "column": 9
+          },
+          "end": {
+            "line": 16,
+            "column": 52
+          }
+        }
+      },
+      "loc": {
+        "start": {
+          "line": 16,
+          "column": 1
+        },
+        "end": {
+          "line": 16,
+          "column": 52
+        }
+      }
+    },
+    {
+      "type": "ImportDeclaration",
+      "source": {
+        "type": "StringLiteral",
+        "value": "import_tests/packages/recursive",
+        "loc": {
+          "start": {
+            "line": 18,
+            "column": 15
+          },
+          "end": {
+            "line": 18,
+            "column": 48
+          }
+        }
+      },
+      "specifiers": [
+        {
+          "type": "ImportNamespaceSpecifier",
+          "local": {
+            "type": "Identifier",
+            "name": "",
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 1,
+                "column": 1
+              },
+              "end": {
+                "line": 1,
+                "column": 1
+              }
+            }
+          },
+          "loc": {
+            "start": {
+              "line": 18,
+              "column": 8
+            },
+            "end": {
+              "line": 18,
+              "column": 14
+            }
+          }
+        }
+      ],
+      "loc": {
+        "start": {
+          "line": 18,
+          "column": 1
+        },
+        "end": {
+          "line": 18,
+          "column": 49
+        }
+      }
+    },
+    {
+      "type": "ClassDeclaration",
+      "definition": {
+        "id": {
+          "type": "Identifier",
+          "name": "ETSGLOBAL",
+          "decorators": [],
+          "loc": {
+            "start": {
+              "line": 1,
+              "column": 1
+            },
+            "end": {
+              "line": 1,
+              "column": 1
+            }
+          }
+        },
+        "superClass": null,
+        "implements": [],
+        "body": [
+          {
+            "type": "ClassProperty",
+            "key": {
+              "type": "Identifier",
+              "name": "b",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 20,
+                  "column": 12
+                },
+                "end": {
+                  "line": 20,
+                  "column": 13
+                }
+              }
+            },
+            "value": {
+              "type": "StringLiteral",
+              "value": "hello",
+              "loc": {
+                "start": {
+                  "line": 20,
+                  "column": 24
+                },
+                "end": {
+                  "line": 20,
+                  "column": 31
+                }
+              }
+            },
+            "accessibility": "public",
+            "static": true,
+            "readonly": false,
+            "declare": false,
+            "optional": false,
+            "computed": false,
+            "typeAnnotation": {
+              "type": "ETSTypeReference",
+              "part": {
+                "type": "ETSTypeReferencePart",
+                "name": {
+                  "type": "Identifier",
+                  "name": "String",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 20,
+                      "column": 15
+                    },
+                    "end": {
+                      "line": 20,
+                      "column": 21
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 20,
+                    "column": 15
+                  },
+                  "end": {
+                    "line": 20,
+                    "column": 23
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 20,
+                  "column": 15
+                },
+                "end": {
+                  "line": 20,
+                  "column": 23
+                }
+              }
+            },
+            "definite": false,
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 20,
+                "column": 12
+              },
+              "end": {
+                "line": 20,
+                "column": 31
+              }
+            }
+          }
+        ],
+        "loc": {
+          "start": {
+            "line": 1,
+            "column": 1
+          },
+          "end": {
+            "line": 1,
+            "column": 1
+          }
+        }
+      },
+      "loc": {
+        "start": {
+          "line": 1,
+          "column": 1
+        },
+        "end": {
+          "line": 1,
+          "column": 1
+        }
+      }
+    }
+  ],
+  "loc": {
+    "start": {
+      "line": 1,
+      "column": 1
+    },
+    "end": {
+      "line": 21,
+      "column": 1
+    }
+  }
+}
diff --git a/ets2panda/test/parser/ets/import_tests/packages/recursive/subpackage_module_1-expected.txt b/ets2panda/test/parser/ets/import_tests/packages/recursive/subpackage_module_1-expected.txt
index 8d3a68b63a..3bc4bcc1f0 100755
--- a/ets2panda/test/parser/ets/import_tests/packages/recursive/subpackage_module_1-expected.txt
+++ b/ets2panda/test/parser/ets/import_tests/packages/recursive/subpackage_module_1-expected.txt
@@ -1 +1,291 @@
-SyntaxError: Recursive import not allowed [subpackage_module_1.ets:18:1]
+{
+  "type": "Program",
+  "statements": [
+    {
+      "type": "ETSPackageDeclaration",
+      "name": {
+        "type": "TSQualifiedName",
+        "left": {
+          "type": "TSQualifiedName",
+          "left": {
+            "type": "Identifier",
+            "name": "import_tests",
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 16,
+                "column": 9
+              },
+              "end": {
+                "line": 16,
+                "column": 21
+              }
+            }
+          },
+          "right": {
+            "type": "Identifier",
+            "name": "packages",
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 16,
+                "column": 22
+              },
+              "end": {
+                "line": 16,
+                "column": 30
+              }
+            }
+          },
+          "loc": {
+            "start": {
+              "line": 16,
+              "column": 9
+            },
+            "end": {
+              "line": 16,
+              "column": 30
+            }
+          }
+        },
+        "right": {
+          "type": "Identifier",
+          "name": "recursive",
+          "decorators": [],
+          "loc": {
+            "start": {
+              "line": 16,
+              "column": 31
+            },
+            "end": {
+              "line": 16,
+              "column": 40
+            }
+          }
+        },
+        "loc": {
+          "start": {
+            "line": 16,
+            "column": 9
+          },
+          "end": {
+            "line": 16,
+            "column": 41
+          }
+        }
+      },
+      "loc": {
+        "start": {
+          "line": 16,
+          "column": 1
+        },
+        "end": {
+          "line": 16,
+          "column": 41
+        }
+      }
+    },
+    {
+      "type": "ImportDeclaration",
+      "source": {
+        "type": "StringLiteral",
+        "value": "import_tests/packages/recursive/subpackage",
+        "loc": {
+          "start": {
+            "line": 18,
+            "column": 15
+          },
+          "end": {
+            "line": 18,
+            "column": 59
+          }
+        }
+      },
+      "specifiers": [
+        {
+          "type": "ImportNamespaceSpecifier",
+          "local": {
+            "type": "Identifier",
+            "name": "",
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 1,
+                "column": 1
+              },
+              "end": {
+                "line": 1,
+                "column": 1
+              }
+            }
+          },
+          "loc": {
+            "start": {
+              "line": 18,
+              "column": 8
+            },
+            "end": {
+              "line": 18,
+              "column": 14
+            }
+          }
+        }
+      ],
+      "loc": {
+        "start": {
+          "line": 18,
+          "column": 1
+        },
+        "end": {
+          "line": 18,
+          "column": 60
+        }
+      }
+    },
+    {
+      "type": "ClassDeclaration",
+      "definition": {
+        "id": {
+          "type": "Identifier",
+          "name": "ETSGLOBAL",
+          "decorators": [],
+          "loc": {
+            "start": {
+              "line": 1,
+              "column": 1
+            },
+            "end": {
+              "line": 1,
+              "column": 1
+            }
+          }
+        },
+        "superClass": null,
+        "implements": [],
+        "body": [
+          {
+            "type": "ClassProperty",
+            "key": {
+              "type": "Identifier",
+              "name": "a",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 20,
+                  "column": 12
+                },
+                "end": {
+                  "line": 20,
+                  "column": 13
+                }
+              }
+            },
+            "value": {
+              "type": "StringLiteral",
+              "value": "hello",
+              "loc": {
+                "start": {
+                  "line": 20,
+                  "column": 24
+                },
+                "end": {
+                  "line": 20,
+                  "column": 31
+                }
+              }
+            },
+            "accessibility": "public",
+            "static": true,
+            "readonly": false,
+            "declare": false,
+            "optional": false,
+            "computed": false,
+            "typeAnnotation": {
+              "type": "ETSTypeReference",
+              "part": {
+                "type": "ETSTypeReferencePart",
+                "name": {
+                  "type": "Identifier",
+                  "name": "String",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 20,
+                      "column": 15
+                    },
+                    "end": {
+                      "line": 20,
+                      "column": 21
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 20,
+                    "column": 15
+                  },
+                  "end": {
+                    "line": 20,
+                    "column": 23
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 20,
+                  "column": 15
+                },
+                "end": {
+                  "line": 20,
+                  "column": 23
+                }
+              }
+            },
+            "definite": false,
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 20,
+                "column": 12
+              },
+              "end": {
+                "line": 20,
+                "column": 31
+              }
+            }
+          }
+        ],
+        "loc": {
+          "start": {
+            "line": 1,
+            "column": 1
+          },
+          "end": {
+            "line": 1,
+            "column": 1
+          }
+        }
+      },
+      "loc": {
+        "start": {
+          "line": 1,
+          "column": 1
+        },
+        "end": {
+          "line": 1,
+          "column": 1
+        }
+      }
+    }
+  ],
+  "loc": {
+    "start": {
+      "line": 1,
+      "column": 1
+    },
+    "end": {
+      "line": 21,
+      "column": 1
+    }
+  }
+}
diff --git a/ets2panda/test/parser/ets/interfaces-expected.txt b/ets2panda/test/parser/ets/interfaces-expected.txt
index 5867d9032d..04999df991 100644
--- a/ets2panda/test/parser/ets/interfaces-expected.txt
+++ b/ets2panda/test/parser/ets/interfaces-expected.txt
@@ -15,12 +15,12 @@
                 "type": "ETSPrimitiveType",
                 "loc": {
                   "start": {
-                    "line": 17,
-                    "column": 8
+                    "line": 1,
+                    "column": 1
                   },
                   "end": {
-                    "line": 17,
-                    "column": 11
+                    "line": 1,
+                    "column": 1
                   }
                 }
               },
@@ -52,12 +52,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 17,
-                        "column": 8
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 17,
-                        "column": 11
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -123,12 +123,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 17,
-                        "column": 8
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 17,
-                        "column": 11
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -160,12 +160,12 @@
                         "type": "ETSPrimitiveType",
                         "loc": {
                           "start": {
-                            "line": 17,
-                            "column": 8
+                            "line": 1,
+                            "column": 1
                           },
                           "end": {
-                            "line": 17,
-                            "column": 11
+                            "line": 1,
+                            "column": 1
                           }
                         }
                       },
@@ -194,12 +194,12 @@
                             "type": "ETSPrimitiveType",
                             "loc": {
                               "start": {
-                                "line": 17,
-                                "column": 8
+                                "line": 1,
+                                "column": 1
                               },
                               "end": {
-                                "line": 17,
-                                "column": 11
+                                "line": 1,
+                                "column": 1
                               }
                             }
                           },
@@ -285,12 +285,12 @@
                 "type": "ETSPrimitiveType",
                 "loc": {
                   "start": {
-                    "line": 17,
-                    "column": 8
+                    "line": 1,
+                    "column": 1
                   },
                   "end": {
-                    "line": 17,
-                    "column": 11
+                    "line": 1,
+                    "column": 1
                   }
                 }
               },
@@ -322,12 +322,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 17,
-                        "column": 8
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 17,
-                        "column": 11
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -356,12 +356,12 @@
                         "type": "ETSPrimitiveType",
                         "loc": {
                           "start": {
-                            "line": 17,
-                            "column": 8
+                            "line": 1,
+                            "column": 1
                           },
                           "end": {
-                            "line": 17,
-                            "column": 11
+                            "line": 1,
+                            "column": 1
                           }
                         }
                       },
@@ -434,12 +434,12 @@
                 "type": "ETSPrimitiveType",
                 "loc": {
                   "start": {
-                    "line": 18,
-                    "column": 8
+                    "line": 1,
+                    "column": 1
                   },
                   "end": {
-                    "line": 18,
-                    "column": 11
+                    "line": 1,
+                    "column": 1
                   }
                 }
               },
@@ -471,12 +471,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 18,
-                        "column": 8
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 18,
-                        "column": 11
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -542,12 +542,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 18,
-                        "column": 8
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 18,
-                        "column": 11
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -579,12 +579,12 @@
                         "type": "ETSPrimitiveType",
                         "loc": {
                           "start": {
-                            "line": 18,
-                            "column": 8
+                            "line": 1,
+                            "column": 1
                           },
                           "end": {
-                            "line": 18,
-                            "column": 11
+                            "line": 1,
+                            "column": 1
                           }
                         }
                       },
@@ -613,12 +613,12 @@
                             "type": "ETSPrimitiveType",
                             "loc": {
                               "start": {
-                                "line": 18,
-                                "column": 8
+                                "line": 1,
+                                "column": 1
                               },
                               "end": {
-                                "line": 18,
-                                "column": 11
+                                "line": 1,
+                                "column": 1
                               }
                             }
                           },
@@ -704,12 +704,12 @@
                 "type": "ETSPrimitiveType",
                 "loc": {
                   "start": {
-                    "line": 18,
-                    "column": 8
+                    "line": 1,
+                    "column": 1
                   },
                   "end": {
-                    "line": 18,
-                    "column": 11
+                    "line": 1,
+                    "column": 1
                   }
                 }
               },
@@ -741,12 +741,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 18,
-                        "column": 8
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 18,
-                        "column": 11
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -775,12 +775,12 @@
                         "type": "ETSPrimitiveType",
                         "loc": {
                           "start": {
-                            "line": 18,
-                            "column": 8
+                            "line": 1,
+                            "column": 1
                           },
                           "end": {
-                            "line": 18,
-                            "column": 11
+                            "line": 1,
+                            "column": 1
                           }
                         }
                       },
diff --git a/ets2panda/test/parser/ets/local-class-access-modifier-private-expected.txt b/ets2panda/test/parser/ets/local-class-access-modifier-private-expected.txt
new file mode 100644
index 0000000000..e56659bd52
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-access-modifier-private-expected.txt
@@ -0,0 +1 @@
+SyntaxError: A local class or interface declaration can not have access modifier [local-class-access-modifier-private.ets:19:5]
diff --git a/ets2panda/test/parser/ets/local-class-access-modifier-private.ets b/ets2panda/test/parser/ets/local-class-access-modifier-private.ets
new file mode 100644
index 0000000000..ebe906434c
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-access-modifier-private.ets
@@ -0,0 +1,22 @@
+
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    private class LocalClass
+    {
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-class-access-modifier-protected-expected.txt b/ets2panda/test/parser/ets/local-class-access-modifier-protected-expected.txt
new file mode 100644
index 0000000000..ecb0378aa5
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-access-modifier-protected-expected.txt
@@ -0,0 +1 @@
+SyntaxError: A local class or interface declaration can not have access modifier [local-class-access-modifier-protected.ets:18:5]
diff --git a/ets2panda/test/parser/ets/local-class-access-modifier-protected.ets b/ets2panda/test/parser/ets/local-class-access-modifier-protected.ets
new file mode 100644
index 0000000000..566c817513
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-access-modifier-protected.ets
@@ -0,0 +1,21 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    protected class LocalClass
+    {
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-class-access-modifier-public-expected.txt b/ets2panda/test/parser/ets/local-class-access-modifier-public-expected.txt
new file mode 100644
index 0000000000..b8826e134b
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-access-modifier-public-expected.txt
@@ -0,0 +1 @@
+SyntaxError: A local class or interface declaration can not have access modifier [local-class-access-modifier-public.ets:18:5]
diff --git a/ets2panda/test/parser/ets/local-class-access-modifier-public.ets b/ets2panda/test/parser/ets/local-class-access-modifier-public.ets
new file mode 100644
index 0000000000..58787a9afe
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-access-modifier-public.ets
@@ -0,0 +1,21 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    public class LocalClass
+    {
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-class-expected.txt b/ets2panda/test/parser/ets/local-class-expected.txt
new file mode 100644
index 0000000000..f317ab4ea7
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-expected.txt
@@ -0,0 +1,425 @@
+{
+  "type": "Program",
+  "statements": [
+    {
+      "type": "ClassDeclaration",
+      "definition": {
+        "id": {
+          "type": "Identifier",
+          "name": "ETSGLOBAL",
+          "decorators": [],
+          "loc": {
+            "start": {
+              "line": 1,
+              "column": 1
+            },
+            "end": {
+              "line": 1,
+              "column": 1
+            }
+          }
+        },
+        "superClass": null,
+        "implements": [],
+        "body": [
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "_$init$_",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "_$init$_",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 1,
+                    "column": 1
+                  },
+                  "end": {
+                    "line": 1,
+                    "column": 1
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 1,
+                "column": 1
+              },
+              "end": {
+                "line": 1,
+                "column": 1
+              }
+            }
+          },
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "main",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 16,
+                  "column": 10
+                },
+                "end": {
+                  "line": 16,
+                  "column": 14
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "main",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 16,
+                      "column": 10
+                    },
+                    "end": {
+                      "line": 16,
+                      "column": 14
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "returnType": {
+                  "type": "ETSPrimitiveType",
+                  "loc": {
+                    "start": {
+                      "line": 16,
+                      "column": 19
+                    },
+                    "end": {
+                      "line": 16,
+                      "column": 22
+                    }
+                  }
+                },
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [
+                    {
+                      "type": "ClassDeclaration",
+                      "definition": {
+                        "id": {
+                          "type": "Identifier",
+                          "name": "LocalClass",
+                          "decorators": [],
+                          "loc": {
+                            "start": {
+                              "line": 18,
+                              "column": 11
+                            },
+                            "end": {
+                              "line": 18,
+                              "column": 21
+                            }
+                          }
+                        },
+                        "superClass": null,
+                        "implements": [],
+                        "body": [
+                          {
+                            "type": "MethodDefinition",
+                            "key": {
+                              "type": "Identifier",
+                              "name": "constructor",
+                              "decorators": [],
+                              "loc": {
+                                "start": {
+                                  "line": 1,
+                                  "column": 1
+                                },
+                                "end": {
+                                  "line": 1,
+                                  "column": 1
+                                }
+                              }
+                            },
+                            "kind": "constructor",
+                            "static": false,
+                            "optional": false,
+                            "computed": false,
+                            "value": {
+                              "type": "FunctionExpression",
+                              "function": {
+                                "type": "ScriptFunction",
+                                "id": {
+                                  "type": "Identifier",
+                                  "name": "constructor",
+                                  "decorators": [],
+                                  "loc": {
+                                    "start": {
+                                      "line": 1,
+                                      "column": 1
+                                    },
+                                    "end": {
+                                      "line": 1,
+                                      "column": 1
+                                    }
+                                  }
+                                },
+                                "generator": false,
+                                "async": false,
+                                "expression": false,
+                                "params": [],
+                                "body": {
+                                  "type": "BlockStatement",
+                                  "statements": [],
+                                  "loc": {
+                                    "start": {
+                                      "line": 1,
+                                      "column": 1
+                                    },
+                                    "end": {
+                                      "line": 1,
+                                      "column": 1
+                                    }
+                                  }
+                                },
+                                "loc": {
+                                  "start": {
+                                    "line": 1,
+                                    "column": 1
+                                  },
+                                  "end": {
+                                    "line": 1,
+                                    "column": 1
+                                  }
+                                }
+                              },
+                              "loc": {
+                                "start": {
+                                  "line": 1,
+                                  "column": 1
+                                },
+                                "end": {
+                                  "line": 1,
+                                  "column": 1
+                                }
+                              }
+                            },
+                            "overloads": [],
+                            "decorators": [],
+                            "loc": {
+                              "start": {
+                                "line": 18,
+                                "column": 25
+                              },
+                              "end": {
+                                "line": 18,
+                                "column": 25
+                              }
+                            }
+                          }
+                        ],
+                        "loc": {
+                          "start": {
+                            "line": 18,
+                            "column": 22
+                          },
+                          "end": {
+                            "line": 18,
+                            "column": 25
+                          }
+                        }
+                      },
+                      "loc": {
+                        "start": {
+                          "line": 18,
+                          "column": 5
+                        },
+                        "end": {
+                          "line": 18,
+                          "column": 25
+                        }
+                      }
+                    },
+                    {
+                      "type": "ReturnStatement",
+                      "argument": {
+                        "type": "NumberLiteral",
+                        "value": 0,
+                        "loc": {
+                          "start": {
+                            "line": 19,
+                            "column": 12
+                          },
+                          "end": {
+                            "line": 19,
+                            "column": 13
+                          }
+                        }
+                      },
+                      "loc": {
+                        "start": {
+                          "line": 19,
+                          "column": 5
+                        },
+                        "end": {
+                          "line": 19,
+                          "column": 14
+                        }
+                      }
+                    }
+                  ],
+                  "loc": {
+                    "start": {
+                      "line": 17,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 20,
+                      "column": 2
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 16,
+                    "column": 14
+                  },
+                  "end": {
+                    "line": 20,
+                    "column": 2
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 16,
+                  "column": 14
+                },
+                "end": {
+                  "line": 20,
+                  "column": 2
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 16,
+                "column": 1
+              },
+              "end": {
+                "line": 20,
+                "column": 2
+              }
+            }
+          }
+        ],
+        "loc": {
+          "start": {
+            "line": 1,
+            "column": 1
+          },
+          "end": {
+            "line": 1,
+            "column": 1
+          }
+        }
+      },
+      "loc": {
+        "start": {
+          "line": 1,
+          "column": 1
+        },
+        "end": {
+          "line": 1,
+          "column": 1
+        }
+      }
+    }
+  ],
+  "loc": {
+    "start": {
+      "line": 1,
+      "column": 1
+    },
+    "end": {
+      "line": 20,
+      "column": 2
+    }
+  }
+}
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-private1-expected.txt b/ets2panda/test/parser/ets/local-class-member-access-modifier-private1-expected.txt
new file mode 100644
index 0000000000..a5a73903e0
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-private1-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local class declaration members can not have access modifies [local-class-member-access-modifier-private1.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-private1.ets b/ets2panda/test/parser/ets/local-class-member-access-modifier-private1.ets
new file mode 100644
index 0000000000..4842198e5e
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-private1.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    class LocalClass
+    {
+        private property : int;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-private2-expected.txt b/ets2panda/test/parser/ets/local-class-member-access-modifier-private2-expected.txt
new file mode 100644
index 0000000000..1794411ab8
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-private2-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local class declaration members can not have access modifies [local-class-member-access-modifier-private2.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-private2.ets b/ets2panda/test/parser/ets/local-class-member-access-modifier-private2.ets
new file mode 100644
index 0000000000..d076baa1a7
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-private2.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    class LocalClass
+    {
+        private method() : void;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-protected1-expected.txt b/ets2panda/test/parser/ets/local-class-member-access-modifier-protected1-expected.txt
new file mode 100644
index 0000000000..cf37e0b470
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-protected1-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local class declaration members can not have access modifies [local-class-member-access-modifier-protected1.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-protected1.ets b/ets2panda/test/parser/ets/local-class-member-access-modifier-protected1.ets
new file mode 100644
index 0000000000..7c292c50dd
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-protected1.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    class LocalClass
+    {
+        protected property : int;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-protected2-expected.txt b/ets2panda/test/parser/ets/local-class-member-access-modifier-protected2-expected.txt
new file mode 100644
index 0000000000..e78b256b22
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-protected2-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local class declaration members can not have access modifies [local-class-member-access-modifier-protected2.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-protected2.ets b/ets2panda/test/parser/ets/local-class-member-access-modifier-protected2.ets
new file mode 100644
index 0000000000..d4334b411f
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-protected2.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    class LocalClass
+    {
+        protected method() : void;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-public1-expected.txt b/ets2panda/test/parser/ets/local-class-member-access-modifier-public1-expected.txt
new file mode 100644
index 0000000000..6e312819bb
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-public1-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local class declaration members can not have access modifies [local-class-member-access-modifier-public1.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-public1.ets b/ets2panda/test/parser/ets/local-class-member-access-modifier-public1.ets
new file mode 100644
index 0000000000..1a4cf2c419
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-public1.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    class LocalClass
+    {
+        public property : int;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-public2-expected.txt b/ets2panda/test/parser/ets/local-class-member-access-modifier-public2-expected.txt
new file mode 100644
index 0000000000..05bc52458a
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-public2-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local class declaration members can not have access modifies [local-class-member-access-modifier-public2.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-class-member-access-modifier-public2.ets b/ets2panda/test/parser/ets/local-class-member-access-modifier-public2.ets
new file mode 100644
index 0000000000..57f75dbd3c
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class-member-access-modifier-public2.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    class LocalClass
+    {
+        public method() : void;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-class.ets b/ets2panda/test/parser/ets/local-class.ets
new file mode 100644
index 0000000000..52237f9168
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-class.ets
@@ -0,0 +1,20 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function main() : int
+{
+    class LocalClass { }
+    return 0;
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-interface-access-modifier-private-expected.txt b/ets2panda/test/parser/ets/local-interface-access-modifier-private-expected.txt
new file mode 100644
index 0000000000..b2b274ff4c
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-access-modifier-private-expected.txt
@@ -0,0 +1 @@
+SyntaxError: A local class or interface declaration can not have access modifier [local-interface-access-modifier-private.ets:18:5]
diff --git a/ets2panda/test/parser/ets/local-interface-access-modifier-private.ets b/ets2panda/test/parser/ets/local-interface-access-modifier-private.ets
new file mode 100644
index 0000000000..ebb78d7e7f
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-access-modifier-private.ets
@@ -0,0 +1,21 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    private interface LocalInterface
+    {
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-interface-access-modifier-protected-expected.txt b/ets2panda/test/parser/ets/local-interface-access-modifier-protected-expected.txt
new file mode 100644
index 0000000000..3b79eeef88
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-access-modifier-protected-expected.txt
@@ -0,0 +1 @@
+SyntaxError: A local class or interface declaration can not have access modifier [local-interface-access-modifier-protected.ets:18:5]
diff --git a/ets2panda/test/parser/ets/local-interface-access-modifier-protected.ets b/ets2panda/test/parser/ets/local-interface-access-modifier-protected.ets
new file mode 100644
index 0000000000..4820997507
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-access-modifier-protected.ets
@@ -0,0 +1,21 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    protected interface LocalInterface
+    {
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-interface-access-modifier-public-expected.txt b/ets2panda/test/parser/ets/local-interface-access-modifier-public-expected.txt
new file mode 100644
index 0000000000..1a1bef4653
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-access-modifier-public-expected.txt
@@ -0,0 +1 @@
+SyntaxError: A local class or interface declaration can not have access modifier [local-interface-access-modifier-public.ets:18:5]
diff --git a/ets2panda/test/parser/ets/local-interface-access-modifier-public.ets b/ets2panda/test/parser/ets/local-interface-access-modifier-public.ets
new file mode 100644
index 0000000000..b0b8d4d371
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-access-modifier-public.ets
@@ -0,0 +1,21 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    public interface LocalInterface
+    {
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-interface-expected.txt b/ets2panda/test/parser/ets/local-interface-expected.txt
new file mode 100644
index 0000000000..e01cce77f7
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-expected.txt
@@ -0,0 +1,331 @@
+{
+  "type": "Program",
+  "statements": [
+    {
+      "type": "ClassDeclaration",
+      "definition": {
+        "id": {
+          "type": "Identifier",
+          "name": "ETSGLOBAL",
+          "decorators": [],
+          "loc": {
+            "start": {
+              "line": 1,
+              "column": 1
+            },
+            "end": {
+              "line": 1,
+              "column": 1
+            }
+          }
+        },
+        "superClass": null,
+        "implements": [],
+        "body": [
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "_$init$_",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "_$init$_",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 1,
+                    "column": 1
+                  },
+                  "end": {
+                    "line": 1,
+                    "column": 1
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 1,
+                "column": 1
+              },
+              "end": {
+                "line": 1,
+                "column": 1
+              }
+            }
+          },
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "main",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 16,
+                  "column": 10
+                },
+                "end": {
+                  "line": 16,
+                  "column": 14
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "main",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 16,
+                      "column": 10
+                    },
+                    "end": {
+                      "line": 16,
+                      "column": 14
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "returnType": {
+                  "type": "ETSPrimitiveType",
+                  "loc": {
+                    "start": {
+                      "line": 16,
+                      "column": 19
+                    },
+                    "end": {
+                      "line": 16,
+                      "column": 22
+                    }
+                  }
+                },
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [
+                    {
+                      "type": "TSInterfaceDeclaration",
+                      "body": {
+                        "type": "TSInterfaceBody",
+                        "body": [],
+                        "loc": {
+                          "start": {
+                            "line": 18,
+                            "column": 30
+                          },
+                          "end": {
+                            "line": 18,
+                            "column": 33
+                          }
+                        }
+                      },
+                      "id": {
+                        "type": "Identifier",
+                        "name": "LocalInterface",
+                        "decorators": [],
+                        "loc": {
+                          "start": {
+                            "line": 18,
+                            "column": 15
+                          },
+                          "end": {
+                            "line": 18,
+                            "column": 29
+                          }
+                        }
+                      },
+                      "extends": [],
+                      "loc": {
+                        "start": {
+                          "line": 18,
+                          "column": 5
+                        },
+                        "end": {
+                          "line": 19,
+                          "column": 11
+                        }
+                      }
+                    },
+                    {
+                      "type": "ReturnStatement",
+                      "argument": {
+                        "type": "NumberLiteral",
+                        "value": 0,
+                        "loc": {
+                          "start": {
+                            "line": 19,
+                            "column": 12
+                          },
+                          "end": {
+                            "line": 19,
+                            "column": 13
+                          }
+                        }
+                      },
+                      "loc": {
+                        "start": {
+                          "line": 19,
+                          "column": 5
+                        },
+                        "end": {
+                          "line": 19,
+                          "column": 14
+                        }
+                      }
+                    }
+                  ],
+                  "loc": {
+                    "start": {
+                      "line": 17,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 20,
+                      "column": 2
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 16,
+                    "column": 14
+                  },
+                  "end": {
+                    "line": 20,
+                    "column": 2
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 16,
+                  "column": 14
+                },
+                "end": {
+                  "line": 20,
+                  "column": 2
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 16,
+                "column": 1
+              },
+              "end": {
+                "line": 20,
+                "column": 2
+              }
+            }
+          }
+        ],
+        "loc": {
+          "start": {
+            "line": 1,
+            "column": 1
+          },
+          "end": {
+            "line": 1,
+            "column": 1
+          }
+        }
+      },
+      "loc": {
+        "start": {
+          "line": 1,
+          "column": 1
+        },
+        "end": {
+          "line": 1,
+          "column": 1
+        }
+      }
+    }
+  ],
+  "loc": {
+    "start": {
+      "line": 1,
+      "column": 1
+    },
+    "end": {
+      "line": 20,
+      "column": 2
+    }
+  }
+}
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-private1-expected.txt b/ets2panda/test/parser/ets/local-interface-member-access-modifier-private1-expected.txt
new file mode 100644
index 0000000000..190c83aa9b
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-private1-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local interface declaration members can not have access modifies [local-interface-member-access-modifier-private1.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-private1.ets b/ets2panda/test/parser/ets/local-interface-member-access-modifier-private1.ets
new file mode 100644
index 0000000000..b772614d55
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-private1.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    interface LocalInterface
+    {
+        private property : int;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-private2-expected.txt b/ets2panda/test/parser/ets/local-interface-member-access-modifier-private2-expected.txt
new file mode 100644
index 0000000000..c10786f859
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-private2-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local interface declaration members can not have access modifies [local-interface-member-access-modifier-private2.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-private2.ets b/ets2panda/test/parser/ets/local-interface-member-access-modifier-private2.ets
new file mode 100644
index 0000000000..fea47b8530
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-private2.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    interface LocalInterface
+    {
+        private method() : void;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected1-expected.txt b/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected1-expected.txt
new file mode 100644
index 0000000000..c648044306
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected1-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local interface declaration members can not have access modifies [local-interface-member-access-modifier-protected1.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected1.ets b/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected1.ets
new file mode 100644
index 0000000000..4b239afd40
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected1.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    interface LocalInterface
+    {
+        protected property : int;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected2-expected.txt b/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected2-expected.txt
new file mode 100644
index 0000000000..f245a63431
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected2-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local interface declaration members can not have access modifies [local-interface-member-access-modifier-protected2.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected2.ets b/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected2.ets
new file mode 100644
index 0000000000..11ff6ffd2b
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-protected2.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    interface LocalInterface
+    {
+        protected method() : void;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-public1-expected.txt b/ets2panda/test/parser/ets/local-interface-member-access-modifier-public1-expected.txt
new file mode 100644
index 0000000000..984d6657ff
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-public1-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local interface declaration members can not have access modifies [local-interface-member-access-modifier-public1.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-public1.ets b/ets2panda/test/parser/ets/local-interface-member-access-modifier-public1.ets
new file mode 100644
index 0000000000..9d01a6df98
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-public1.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    interface LocalInterface
+    {
+        public property : int;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-public2-expected.txt b/ets2panda/test/parser/ets/local-interface-member-access-modifier-public2-expected.txt
new file mode 100644
index 0000000000..8f48cf7201
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-public2-expected.txt
@@ -0,0 +1 @@
+SyntaxError: Local interface declaration members can not have access modifies [local-interface-member-access-modifier-public2.ets:20:9]
diff --git a/ets2panda/test/parser/ets/local-interface-member-access-modifier-public2.ets b/ets2panda/test/parser/ets/local-interface-member-access-modifier-public2.ets
new file mode 100644
index 0000000000..26211d4f8c
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface-member-access-modifier-public2.ets
@@ -0,0 +1,22 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo()
+{
+    interface LocalInterface
+    {
+        public method() : void;
+    }
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/local-interface.ets b/ets2panda/test/parser/ets/local-interface.ets
new file mode 100644
index 0000000000..ba355d70cc
--- /dev/null
+++ b/ets2panda/test/parser/ets/local-interface.ets
@@ -0,0 +1,20 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function main() : int
+{
+    interface LocalInterface { }
+    return 0;
+}
\ No newline at end of file
diff --git a/ets2panda/test/parser/ets/localClassIsPermitted-expected.txt b/ets2panda/test/parser/ets/localClassIsPermitted-expected.txt
index 2935597f31..bac179ba08 100644
--- a/ets2panda/test/parser/ets/localClassIsPermitted-expected.txt
+++ b/ets2panda/test/parser/ets/localClassIsPermitted-expected.txt
@@ -1 +1,500 @@
-SyntaxError: Illegal start of expression [localClassIsPermitted.ets:18:9]
+{
+  "type": "Program",
+  "statements": [
+    {
+      "type": "ClassDeclaration",
+      "definition": {
+        "id": {
+          "type": "Identifier",
+          "name": "Klass",
+          "decorators": [],
+          "loc": {
+            "start": {
+              "line": 16,
+              "column": 7
+            },
+            "end": {
+              "line": 16,
+              "column": 12
+            }
+          }
+        },
+        "superClass": null,
+        "implements": [],
+        "body": [
+          {
+            "type": "ClassStaticBlock",
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "<cctor>",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": true,
+                "params": [],
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [
+                    {
+                      "type": "ClassDeclaration",
+                      "definition": {
+                        "id": {
+                          "type": "Identifier",
+                          "name": "Local",
+                          "decorators": [],
+                          "loc": {
+                            "start": {
+                              "line": 18,
+                              "column": 15
+                            },
+                            "end": {
+                              "line": 18,
+                              "column": 20
+                            }
+                          }
+                        },
+                        "superClass": null,
+                        "implements": [],
+                        "body": [
+                          {
+                            "type": "MethodDefinition",
+                            "key": {
+                              "type": "Identifier",
+                              "name": "constructor",
+                              "decorators": [],
+                              "loc": {
+                                "start": {
+                                  "line": 1,
+                                  "column": 1
+                                },
+                                "end": {
+                                  "line": 1,
+                                  "column": 1
+                                }
+                              }
+                            },
+                            "kind": "constructor",
+                            "static": false,
+                            "optional": false,
+                            "computed": false,
+                            "value": {
+                              "type": "FunctionExpression",
+                              "function": {
+                                "type": "ScriptFunction",
+                                "id": {
+                                  "type": "Identifier",
+                                  "name": "constructor",
+                                  "decorators": [],
+                                  "loc": {
+                                    "start": {
+                                      "line": 1,
+                                      "column": 1
+                                    },
+                                    "end": {
+                                      "line": 1,
+                                      "column": 1
+                                    }
+                                  }
+                                },
+                                "generator": false,
+                                "async": false,
+                                "expression": false,
+                                "params": [],
+                                "body": {
+                                  "type": "BlockStatement",
+                                  "statements": [],
+                                  "loc": {
+                                    "start": {
+                                      "line": 1,
+                                      "column": 1
+                                    },
+                                    "end": {
+                                      "line": 1,
+                                      "column": 1
+                                    }
+                                  }
+                                },
+                                "loc": {
+                                  "start": {
+                                    "line": 1,
+                                    "column": 1
+                                  },
+                                  "end": {
+                                    "line": 1,
+                                    "column": 1
+                                  }
+                                }
+                              },
+                              "loc": {
+                                "start": {
+                                  "line": 1,
+                                  "column": 1
+                                },
+                                "end": {
+                                  "line": 1,
+                                  "column": 1
+                                }
+                              }
+                            },
+                            "overloads": [],
+                            "decorators": [],
+                            "loc": {
+                              "start": {
+                                "line": 20,
+                                "column": 10
+                              },
+                              "end": {
+                                "line": 20,
+                                "column": 10
+                              }
+                            }
+                          }
+                        ],
+                        "loc": {
+                          "start": {
+                            "line": 18,
+                            "column": 21
+                          },
+                          "end": {
+                            "line": 20,
+                            "column": 10
+                          }
+                        }
+                      },
+                      "loc": {
+                        "start": {
+                          "line": 18,
+                          "column": 9
+                        },
+                        "end": {
+                          "line": 20,
+                          "column": 10
+                        }
+                      }
+                    }
+                  ],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 1,
+                    "column": 1
+                  },
+                  "end": {
+                    "line": 1,
+                    "column": 1
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "loc": {
+              "start": {
+                "line": 21,
+                "column": 5
+              },
+              "end": {
+                "line": 21,
+                "column": 6
+              }
+            }
+          },
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "constructor",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "kind": "constructor",
+            "static": false,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "constructor",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 1,
+                    "column": 1
+                  },
+                  "end": {
+                    "line": 1,
+                    "column": 1
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 22,
+                "column": 2
+              },
+              "end": {
+                "line": 22,
+                "column": 2
+              }
+            }
+          }
+        ],
+        "loc": {
+          "start": {
+            "line": 16,
+            "column": 13
+          },
+          "end": {
+            "line": 22,
+            "column": 2
+          }
+        }
+      },
+      "loc": {
+        "start": {
+          "line": 16,
+          "column": 1
+        },
+        "end": {
+          "line": 22,
+          "column": 2
+        }
+      }
+    },
+    {
+      "type": "ClassDeclaration",
+      "definition": {
+        "id": {
+          "type": "Identifier",
+          "name": "ETSGLOBAL",
+          "decorators": [],
+          "loc": {
+            "start": {
+              "line": 1,
+              "column": 1
+            },
+            "end": {
+              "line": 1,
+              "column": 1
+            }
+          }
+        },
+        "superClass": null,
+        "implements": [],
+        "body": [
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "_$init$_",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "_$init$_",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 1,
+                    "column": 1
+                  },
+                  "end": {
+                    "line": 1,
+                    "column": 1
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 1,
+                "column": 1
+              },
+              "end": {
+                "line": 1,
+                "column": 1
+              }
+            }
+          }
+        ],
+        "loc": {
+          "start": {
+            "line": 1,
+            "column": 1
+          },
+          "end": {
+            "line": 1,
+            "column": 1
+          }
+        }
+      },
+      "loc": {
+        "start": {
+          "line": 1,
+          "column": 1
+        },
+        "end": {
+          "line": 1,
+          "column": 1
+        }
+      }
+    }
+  ],
+  "loc": {
+    "start": {
+      "line": 1,
+      "column": 1
+    },
+    "end": {
+      "line": 23,
+      "column": 1
+    }
+  }
+}
diff --git a/ets2panda/test/parser/ets/named_types-expected.txt b/ets2panda/test/parser/ets/named_types-expected.txt
index a5c932661c..0080c199f0 100644
--- a/ets2panda/test/parser/ets/named_types-expected.txt
+++ b/ets2panda/test/parser/ets/named_types-expected.txt
@@ -1,1086 +1 @@
-{
-  "type": "Program",
-  "statements": [
-    {
-      "type": "ETSPackageDeclaration",
-      "name": {
-        "type": "TSQualifiedName",
-        "left": {
-          "type": "TSQualifiedName",
-          "left": {
-            "type": "TSQualifiedName",
-            "left": {
-              "type": "TSQualifiedName",
-              "left": {
-                "type": "Identifier",
-                "name": "com",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 16,
-                    "column": 9
-                  },
-                  "end": {
-                    "line": 16,
-                    "column": 12
-                  }
-                }
-              },
-              "right": {
-                "type": "Identifier",
-                "name": "huawei",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 16,
-                    "column": 13
-                  },
-                  "end": {
-                    "line": 16,
-                    "column": 19
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 16,
-                  "column": 9
-                },
-                "end": {
-                  "line": 16,
-                  "column": 19
-                }
-              }
-            },
-            "right": {
-              "type": "Identifier",
-              "name": "migrationtool",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 16,
-                  "column": 20
-                },
-                "end": {
-                  "line": 16,
-                  "column": 33
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 16,
-                "column": 9
-              },
-              "end": {
-                "line": 16,
-                "column": 33
-              }
-            }
-          },
-          "right": {
-            "type": "Identifier",
-            "name": "test",
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 16,
-                "column": 34
-              },
-              "end": {
-                "line": 16,
-                "column": 38
-              }
-            }
-          },
-          "loc": {
-            "start": {
-              "line": 16,
-              "column": 9
-            },
-            "end": {
-              "line": 16,
-              "column": 38
-            }
-          }
-        },
-        "right": {
-          "type": "Identifier",
-          "name": "ets",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 16,
-              "column": 39
-            },
-            "end": {
-              "line": 16,
-              "column": 42
-            }
-          }
-        },
-        "loc": {
-          "start": {
-            "line": 16,
-            "column": 9
-          },
-          "end": {
-            "line": 16,
-            "column": 43
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 16,
-          "column": 1
-        },
-        "end": {
-          "line": 16,
-          "column": 43
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "named_types",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 20,
-              "column": 12
-            },
-            "end": {
-              "line": 20,
-              "column": 23
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "ClassProperty",
-            "key": {
-              "type": "Identifier",
-              "name": "text",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 21,
-                  "column": 5
-                },
-                "end": {
-                  "line": 21,
-                  "column": 9
-                }
-              }
-            },
-            "accessibility": "public",
-            "static": false,
-            "readonly": false,
-            "declare": false,
-            "optional": false,
-            "computed": false,
-            "typeAnnotation": {
-              "type": "ETSTypeReference",
-              "part": {
-                "type": "ETSTypeReferencePart",
-                "name": {
-                  "type": "TSQualifiedName",
-                  "left": {
-                    "type": "TSQualifiedName",
-                    "left": {
-                      "type": "Identifier",
-                      "name": "ets",
-                      "decorators": [],
-                      "loc": {
-                        "start": {
-                          "line": 21,
-                          "column": 12
-                        },
-                        "end": {
-                          "line": 21,
-                          "column": 15
-                        }
-                      }
-                    },
-                    "right": {
-                      "type": "Identifier",
-                      "name": "lang",
-                      "decorators": [],
-                      "loc": {
-                        "start": {
-                          "line": 21,
-                          "column": 16
-                        },
-                        "end": {
-                          "line": 21,
-                          "column": 20
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 21,
-                        "column": 12
-                      },
-                      "end": {
-                        "line": 21,
-                        "column": 20
-                      }
-                    }
-                  },
-                  "right": {
-                    "type": "Identifier",
-                    "name": "String",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 21,
-                        "column": 21
-                      },
-                      "end": {
-                        "line": 21,
-                        "column": 27
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 21,
-                      "column": 12
-                    },
-                    "end": {
-                      "line": 21,
-                      "column": 29
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 21,
-                    "column": 12
-                  },
-                  "end": {
-                    "line": 21,
-                    "column": 29
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 21,
-                  "column": 12
-                },
-                "end": {
-                  "line": 21,
-                  "column": 29
-                }
-              }
-            },
-            "definite": false,
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 1,
-                "column": 1
-              },
-              "end": {
-                "line": 1,
-                "column": 1
-              }
-            }
-          },
-          {
-            "type": "ClassDeclaration",
-            "definition": {
-              "id": {
-                "type": "Identifier",
-                "name": "inner",
-                "decorators": [],
-                "loc": {
-                  "start": {
-                    "line": 22,
-                    "column": 30
-                  },
-                  "end": {
-                    "line": 22,
-                    "column": 35
-                  }
-                }
-              },
-              "typeParameters": {
-                "type": "TSTypeParameterDeclaration",
-                "params": [
-                  {
-                    "type": "TSTypeParameter",
-                    "name": {
-                      "type": "Identifier",
-                      "name": "T",
-                      "decorators": [],
-                      "loc": {
-                        "start": {
-                          "line": 22,
-                          "column": 36
-                        },
-                        "end": {
-                          "line": 22,
-                          "column": 37
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 22,
-                        "column": 36
-                      },
-                      "end": {
-                        "line": 22,
-                        "column": 38
-                      }
-                    }
-                  }
-                ],
-                "loc": {
-                  "start": {
-                    "line": 22,
-                    "column": 35
-                  },
-                  "end": {
-                    "line": 22,
-                    "column": 38
-                  }
-                }
-              },
-              "superClass": null,
-              "implements": [],
-              "body": [
-                {
-                  "type": "ClassDeclaration",
-                  "definition": {
-                    "id": {
-                      "type": "Identifier",
-                      "name": "innertoo",
-                      "decorators": [],
-                      "loc": {
-                        "start": {
-                          "line": 23,
-                          "column": 27
-                        },
-                        "end": {
-                          "line": 23,
-                          "column": 35
-                        }
-                      }
-                    },
-                    "superClass": null,
-                    "implements": [],
-                    "body": [
-                      {
-                        "type": "MethodDefinition",
-                        "key": {
-                          "type": "Identifier",
-                          "name": "constructor",
-                          "decorators": [],
-                          "loc": {
-                            "start": {
-                              "line": 1,
-                              "column": 1
-                            },
-                            "end": {
-                              "line": 1,
-                              "column": 1
-                            }
-                          }
-                        },
-                        "kind": "constructor",
-                        "static": false,
-                        "optional": false,
-                        "computed": false,
-                        "value": {
-                          "type": "FunctionExpression",
-                          "function": {
-                            "type": "ScriptFunction",
-                            "id": {
-                              "type": "Identifier",
-                              "name": "constructor",
-                              "decorators": [],
-                              "loc": {
-                                "start": {
-                                  "line": 1,
-                                  "column": 1
-                                },
-                                "end": {
-                                  "line": 1,
-                                  "column": 1
-                                }
-                              }
-                            },
-                            "generator": false,
-                            "async": false,
-                            "expression": false,
-                            "params": [],
-                            "body": {
-                              "type": "BlockStatement",
-                              "statements": [],
-                              "loc": {
-                                "start": {
-                                  "line": 1,
-                                  "column": 1
-                                },
-                                "end": {
-                                  "line": 1,
-                                  "column": 1
-                                }
-                              }
-                            },
-                            "loc": {
-                              "start": {
-                                "line": 1,
-                                "column": 1
-                              },
-                              "end": {
-                                "line": 1,
-                                "column": 1
-                              }
-                            }
-                          },
-                          "loc": {
-                            "start": {
-                              "line": 1,
-                              "column": 1
-                            },
-                            "end": {
-                              "line": 1,
-                              "column": 1
-                            }
-                          }
-                        },
-                        "overloads": [],
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 24,
-                            "column": 10
-                          },
-                          "end": {
-                            "line": 24,
-                            "column": 10
-                          }
-                        }
-                      }
-                    ],
-                    "loc": {
-                      "start": {
-                        "line": 23,
-                        "column": 37
-                      },
-                      "end": {
-                        "line": 24,
-                        "column": 10
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 23,
-                      "column": 21
-                    },
-                    "end": {
-                      "line": 24,
-                      "column": 10
-                    }
-                  }
-                },
-                {
-                  "type": "MethodDefinition",
-                  "key": {
-                    "type": "Identifier",
-                    "name": "constructor",
-                    "decorators": [],
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "kind": "constructor",
-                  "static": false,
-                  "optional": false,
-                  "computed": false,
-                  "value": {
-                    "type": "FunctionExpression",
-                    "function": {
-                      "type": "ScriptFunction",
-                      "id": {
-                        "type": "Identifier",
-                        "name": "constructor",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "generator": false,
-                      "async": false,
-                      "expression": false,
-                      "params": [],
-                      "body": {
-                        "type": "BlockStatement",
-                        "statements": [],
-                        "loc": {
-                          "start": {
-                            "line": 1,
-                            "column": 1
-                          },
-                          "end": {
-                            "line": 1,
-                            "column": 1
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 1,
-                          "column": 1
-                        },
-                        "end": {
-                          "line": 1,
-                          "column": 1
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 1,
-                        "column": 1
-                      },
-                      "end": {
-                        "line": 1,
-                        "column": 1
-                      }
-                    }
-                  },
-                  "overloads": [],
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 26,
-                      "column": 6
-                    },
-                    "end": {
-                      "line": 26,
-                      "column": 6
-                    }
-                  }
-                }
-              ],
-              "loc": {
-                "start": {
-                  "line": 22,
-                  "column": 39
-                },
-                "end": {
-                  "line": 26,
-                  "column": 6
-                }
-              }
-            },
-            "loc": {
-              "start": {
-                "line": 22,
-                "column": 24
-              },
-              "end": {
-                "line": 26,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 28,
-                "column": 2
-              },
-              "end": {
-                "line": 28,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 20,
-            "column": 25
-          },
-          "end": {
-            "line": 28,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 20,
-          "column": 6
-        },
-        "end": {
-          "line": 28,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "auxilliary",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 30,
-              "column": 12
-            },
-            "end": {
-              "line": 30,
-              "column": 22
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "foo",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 31,
-                  "column": 17
-                },
-                "end": {
-                  "line": 31,
-                  "column": 20
-                }
-              }
-            },
-            "kind": "method",
-            "accessibility": "public",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "foo",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 31,
-                      "column": 17
-                    },
-                    "end": {
-                      "line": 31,
-                      "column": 20
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "returnType": {
-                  "type": "ETSTypeReference",
-                  "part": {
-                    "type": "ETSTypeReferencePart",
-                    "name": {
-                      "type": "TSQualifiedName",
-                      "left": {
-                        "type": "Identifier",
-                        "name": "named_types",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 31,
-                            "column": 24
-                          },
-                          "end": {
-                            "line": 31,
-                            "column": 35
-                          }
-                        }
-                      },
-                      "right": {
-                        "type": "Identifier",
-                        "name": "inner",
-                        "decorators": [],
-                        "loc": {
-                          "start": {
-                            "line": 31,
-                            "column": 36
-                          },
-                          "end": {
-                            "line": 31,
-                            "column": 41
-                          }
-                        }
-                      },
-                      "loc": {
-                        "start": {
-                          "line": 31,
-                          "column": 24
-                        },
-                        "end": {
-                          "line": 31,
-                          "column": 43
-                        }
-                      }
-                    },
-                    "loc": {
-                      "start": {
-                        "line": 31,
-                        "column": 24
-                      },
-                      "end": {
-                        "line": 31,
-                        "column": 43
-                      }
-                    }
-                  },
-                  "loc": {
-                    "start": {
-                      "line": 31,
-                      "column": 24
-                    },
-                    "end": {
-                      "line": 31,
-                      "column": 43
-                    }
-                  }
-                },
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 31,
-                      "column": 42
-                    },
-                    "end": {
-                      "line": 32,
-                      "column": 6
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 31,
-                    "column": 20
-                  },
-                  "end": {
-                    "line": 32,
-                    "column": 6
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 31,
-                  "column": 20
-                },
-                "end": {
-                  "line": 32,
-                  "column": 6
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 31,
-                "column": 5
-              },
-              "end": {
-                "line": 32,
-                "column": 6
-              }
-            }
-          },
-          {
-            "type": "MethodDefinition",
-            "key": {
-              "type": "Identifier",
-              "name": "constructor",
-              "decorators": [],
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "kind": "constructor",
-            "static": false,
-            "optional": false,
-            "computed": false,
-            "value": {
-              "type": "FunctionExpression",
-              "function": {
-                "type": "ScriptFunction",
-                "id": {
-                  "type": "Identifier",
-                  "name": "constructor",
-                  "decorators": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "generator": false,
-                "async": false,
-                "expression": false,
-                "params": [],
-                "body": {
-                  "type": "BlockStatement",
-                  "statements": [],
-                  "loc": {
-                    "start": {
-                      "line": 1,
-                      "column": 1
-                    },
-                    "end": {
-                      "line": 1,
-                      "column": 1
-                    }
-                  }
-                },
-                "loc": {
-                  "start": {
-                    "line": 1,
-                    "column": 1
-                  },
-                  "end": {
-                    "line": 1,
-                    "column": 1
-                  }
-                }
-              },
-              "loc": {
-                "start": {
-                  "line": 1,
-                  "column": 1
-                },
-                "end": {
-                  "line": 1,
-                  "column": 1
-                }
-              }
-            },
-            "overloads": [],
-            "decorators": [],
-            "loc": {
-              "start": {
-                "line": 33,
-                "column": 2
-              },
-              "end": {
-                "line": 33,
-                "column": 2
-              }
-            }
-          }
-        ],
-        "loc": {
-          "start": {
-            "line": 30,
-            "column": 24
-          },
-          "end": {
-            "line": 33,
-            "column": 2
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 30,
-          "column": 6
-        },
-        "end": {
-          "line": 33,
-          "column": 2
-        }
-      }
-    },
-    {
-      "type": "ClassDeclaration",
-      "definition": {
-        "id": {
-          "type": "Identifier",
-          "name": "ETSGLOBAL",
-          "decorators": [],
-          "loc": {
-            "start": {
-              "line": 1,
-              "column": 1
-            },
-            "end": {
-              "line": 1,
-              "column": 1
-            }
-          }
-        },
-        "superClass": null,
-        "implements": [],
-        "body": [],
-        "loc": {
-          "start": {
-            "line": 1,
-            "column": 1
-          },
-          "end": {
-            "line": 1,
-            "column": 1
-          }
-        }
-      },
-      "loc": {
-        "start": {
-          "line": 1,
-          "column": 1
-        },
-        "end": {
-          "line": 1,
-          "column": 1
-        }
-      }
-    }
-  ],
-  "loc": {
-    "start": {
-      "line": 1,
-      "column": 1
-    },
-    "end": {
-      "line": 35,
-      "column": 1
-    }
-  }
-}
-SyntaxError: Cannot find type 'ets'. [named_types.ets:21:12]
+SyntaxError: Local type declaration (class, struct, interface and enum) support is not yet implemented. [named_types.ets:22:19]
diff --git a/ets2panda/test/parser/ets/null-coalesc-negative-expected.txt b/ets2panda/test/parser/ets/null-coalesc-negative-expected.txt
index aef2a178ed..c187e0df58 100644
--- a/ets2panda/test/parser/ets/null-coalesc-negative-expected.txt
+++ b/ets2panda/test/parser/ets/null-coalesc-negative-expected.txt
@@ -62,12 +62,12 @@
             "decorators": [],
             "loc": {
               "start": {
-                "line": 1,
-                "column": 1
+                "line": 17,
+                "column": 13
               },
               "end": {
-                "line": 1,
-                "column": 1
+                "line": 17,
+                "column": 23
               }
             }
           },
@@ -458,7 +458,35 @@
                 "expression": false,
                 "params": [],
                 "returnType": {
-                  "type": "ETSPrimitiveType",
+                  "type": "ETSTypeReference",
+                  "part": {
+                    "type": "ETSTypeReferencePart",
+                    "name": {
+                      "type": "Identifier",
+                      "name": "void",
+                      "decorators": [],
+                      "loc": {
+                        "start": {
+                          "line": 24,
+                          "column": 16
+                        },
+                        "end": {
+                          "line": 24,
+                          "column": 20
+                        }
+                      }
+                    },
+                    "loc": {
+                      "start": {
+                        "line": 24,
+                        "column": 16
+                      },
+                      "end": {
+                        "line": 24,
+                        "column": 22
+                      }
+                    }
+                  },
                   "loc": {
                     "start": {
                       "line": 24,
@@ -466,7 +494,7 @@
                     },
                     "end": {
                       "line": 24,
-                      "column": 20
+                      "column": 22
                     }
                   }
                 },
@@ -905,6 +933,100 @@
         "superClass": null,
         "implements": [],
         "body": [
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "_$init$_",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "_$init$_",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 1,
+                    "column": 1
+                  },
+                  "end": {
+                    "line": 1,
+                    "column": 1
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 1,
+                "column": 1
+              },
+              "end": {
+                "line": 1,
+                "column": 1
+              }
+            }
+          },
           {
             "type": "MethodDefinition",
             "key": {
@@ -951,7 +1073,35 @@
                 "expression": false,
                 "params": [],
                 "returnType": {
-                  "type": "ETSPrimitiveType",
+                  "type": "ETSTypeReference",
+                  "part": {
+                    "type": "ETSTypeReferencePart",
+                    "name": {
+                      "type": "Identifier",
+                      "name": "void",
+                      "decorators": [],
+                      "loc": {
+                        "start": {
+                          "line": 32,
+                          "column": 18
+                        },
+                        "end": {
+                          "line": 32,
+                          "column": 22
+                        }
+                      }
+                    },
+                    "loc": {
+                      "start": {
+                        "line": 32,
+                        "column": 18
+                      },
+                      "end": {
+                        "line": 32,
+                        "column": 24
+                      }
+                    }
+                  },
                   "loc": {
                     "start": {
                       "line": 32,
@@ -959,7 +1109,7 @@
                     },
                     "end": {
                       "line": 32,
-                      "column": 22
+                      "column": 24
                     }
                   }
                 },
diff --git a/ets2panda/test/parser/ets/test_interface-expected.txt b/ets2panda/test/parser/ets/test_interface-expected.txt
index 176f14aabf..f9d22cdea2 100644
--- a/ets2panda/test/parser/ets/test_interface-expected.txt
+++ b/ets2panda/test/parser/ets/test_interface-expected.txt
@@ -155,12 +155,12 @@
                 "type": "ETSPrimitiveType",
                 "loc": {
                   "start": {
-                    "line": 21,
-                    "column": 9
+                    "line": 1,
+                    "column": 1
                   },
                   "end": {
-                    "line": 21,
-                    "column": 12
+                    "line": 1,
+                    "column": 1
                   }
                 }
               },
@@ -192,12 +192,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 21,
-                        "column": 9
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 21,
-                        "column": 12
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -263,12 +263,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 21,
-                        "column": 9
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 21,
-                        "column": 12
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -300,12 +300,12 @@
                         "type": "ETSPrimitiveType",
                         "loc": {
                           "start": {
-                            "line": 21,
-                            "column": 9
+                            "line": 1,
+                            "column": 1
                           },
                           "end": {
-                            "line": 21,
-                            "column": 12
+                            "line": 1,
+                            "column": 1
                           }
                         }
                       },
@@ -334,12 +334,12 @@
                             "type": "ETSPrimitiveType",
                             "loc": {
                               "start": {
-                                "line": 21,
-                                "column": 9
+                                "line": 1,
+                                "column": 1
                               },
                               "end": {
-                                "line": 21,
-                                "column": 12
+                                "line": 1,
+                                "column": 1
                               }
                             }
                           },
@@ -425,12 +425,12 @@
                 "type": "ETSPrimitiveType",
                 "loc": {
                   "start": {
-                    "line": 21,
-                    "column": 9
+                    "line": 1,
+                    "column": 1
                   },
                   "end": {
-                    "line": 21,
-                    "column": 12
+                    "line": 1,
+                    "column": 1
                   }
                 }
               },
@@ -462,12 +462,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 21,
-                        "column": 9
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 21,
-                        "column": 12
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -496,12 +496,12 @@
                         "type": "ETSPrimitiveType",
                         "loc": {
                           "start": {
-                            "line": 21,
-                            "column": 9
+                            "line": 1,
+                            "column": 1
                           },
                           "end": {
-                            "line": 21,
-                            "column": 12
+                            "line": 1,
+                            "column": 1
                           }
                         }
                       },
@@ -574,12 +574,12 @@
                 "type": "ETSPrimitiveType",
                 "loc": {
                   "start": {
-                    "line": 22,
-                    "column": 10
+                    "line": 1,
+                    "column": 1
                   },
                   "end": {
-                    "line": 22,
-                    "column": 16
+                    "line": 1,
+                    "column": 1
                   }
                 }
               },
@@ -611,12 +611,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 22,
-                        "column": 10
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 22,
-                        "column": 16
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -682,12 +682,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 22,
-                        "column": 10
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 22,
-                        "column": 16
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -719,12 +719,12 @@
                         "type": "ETSPrimitiveType",
                         "loc": {
                           "start": {
-                            "line": 22,
-                            "column": 10
+                            "line": 1,
+                            "column": 1
                           },
                           "end": {
-                            "line": 22,
-                            "column": 16
+                            "line": 1,
+                            "column": 1
                           }
                         }
                       },
@@ -753,12 +753,12 @@
                             "type": "ETSPrimitiveType",
                             "loc": {
                               "start": {
-                                "line": 22,
-                                "column": 10
+                                "line": 1,
+                                "column": 1
                               },
                               "end": {
-                                "line": 22,
-                                "column": 16
+                                "line": 1,
+                                "column": 1
                               }
                             }
                           },
@@ -844,12 +844,12 @@
                 "type": "ETSPrimitiveType",
                 "loc": {
                   "start": {
-                    "line": 22,
-                    "column": 10
+                    "line": 1,
+                    "column": 1
                   },
                   "end": {
-                    "line": 22,
-                    "column": 16
+                    "line": 1,
+                    "column": 1
                   }
                 }
               },
@@ -881,12 +881,12 @@
                     "type": "ETSPrimitiveType",
                     "loc": {
                       "start": {
-                        "line": 22,
-                        "column": 10
+                        "line": 1,
+                        "column": 1
                       },
                       "end": {
-                        "line": 22,
-                        "column": 16
+                        "line": 1,
+                        "column": 1
                       }
                     }
                   },
@@ -915,12 +915,12 @@
                         "type": "ETSPrimitiveType",
                         "loc": {
                           "start": {
-                            "line": 22,
-                            "column": 10
+                            "line": 1,
+                            "column": 1
                           },
                           "end": {
-                            "line": 22,
-                            "column": 16
+                            "line": 1,
+                            "column": 1
                           }
                         }
                       },
diff --git a/ets2panda/test/parser/ets/trailing_lambda_tests/trailing_lambda_define_lambda_in_body_capture_variable-expected.txt b/ets2panda/test/parser/ets/trailing_lambda_tests/trailing_lambda_define_lambda_in_body_capture_variable-expected.txt
index e69de29bb2..fe90d86434 100644
--- a/ets2panda/test/parser/ets/trailing_lambda_tests/trailing_lambda_define_lambda_in_body_capture_variable-expected.txt
+++ b/ets2panda/test/parser/ets/trailing_lambda_tests/trailing_lambda_define_lambda_in_body_capture_variable-expected.txt
@@ -0,0 +1,595 @@
+{
+  "type": "Program",
+  "statements": [
+    {
+      "type": "ClassDeclaration",
+      "definition": {
+        "id": {
+          "type": "Identifier",
+          "name": "ETSGLOBAL",
+          "decorators": [],
+          "loc": {
+            "start": {
+              "line": 1,
+              "column": 1
+            },
+            "end": {
+              "line": 1,
+              "column": 1
+            }
+          }
+        },
+        "superClass": null,
+        "implements": [],
+        "body": [
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "_$init$_",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "_$init$_",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [],
+                  "loc": {
+                    "start": {
+                      "line": 1,
+                      "column": 1
+                    },
+                    "end": {
+                      "line": 1,
+                      "column": 1
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 1,
+                    "column": 1
+                  },
+                  "end": {
+                    "line": 1,
+                    "column": 1
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 1,
+                  "column": 1
+                },
+                "end": {
+                  "line": 1,
+                  "column": 1
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 1,
+                "column": 1
+              },
+              "end": {
+                "line": 1,
+                "column": 1
+              }
+            }
+          },
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "foo",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 16,
+                  "column": 10
+                },
+                "end": {
+                  "line": 16,
+                  "column": 13
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "foo",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 16,
+                      "column": 10
+                    },
+                    "end": {
+                      "line": 16,
+                      "column": 13
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [
+                  {
+                    "type": "ETSParameterExpression",
+                    "name": {
+                      "type": "Identifier",
+                      "name": "a0",
+                      "typeAnnotation": {
+                        "type": "ETSFunctionType",
+                        "params": [],
+                        "returnType": {
+                          "type": "ETSTypeReference",
+                          "part": {
+                            "type": "ETSTypeReferencePart",
+                            "name": {
+                              "type": "Identifier",
+                              "name": "void",
+                              "decorators": [],
+                              "loc": {
+                                "start": {
+                                  "line": 16,
+                                  "column": 24
+                                },
+                                "end": {
+                                  "line": 16,
+                                  "column": 28
+                                }
+                              }
+                            },
+                            "loc": {
+                              "start": {
+                                "line": 16,
+                                "column": 24
+                              },
+                              "end": {
+                                "line": 16,
+                                "column": 29
+                              }
+                            }
+                          },
+                          "loc": {
+                            "start": {
+                              "line": 16,
+                              "column": 24
+                            },
+                            "end": {
+                              "line": 16,
+                              "column": 29
+                            }
+                          }
+                        },
+                        "loc": {
+                          "start": {
+                            "line": 16,
+                            "column": 18
+                          },
+                          "end": {
+                            "line": 16,
+                            "column": 29
+                          }
+                        }
+                      },
+                      "decorators": [],
+                      "loc": {
+                        "start": {
+                          "line": 16,
+                          "column": 14
+                        },
+                        "end": {
+                          "line": 16,
+                          "column": 29
+                        }
+                      }
+                    },
+                    "loc": {
+                      "start": {
+                        "line": 16,
+                        "column": 14
+                      },
+                      "end": {
+                        "line": 16,
+                        "column": 29
+                      }
+                    }
+                  }
+                ],
+                "returnType": {
+                  "type": "ETSTypeReference",
+                  "part": {
+                    "type": "ETSTypeReferencePart",
+                    "name": {
+                      "type": "Identifier",
+                      "name": "void",
+                      "decorators": [],
+                      "loc": {
+                        "start": {
+                          "line": 16,
+                          "column": 31
+                        },
+                        "end": {
+                          "line": 16,
+                          "column": 35
+                        }
+                      }
+                    },
+                    "loc": {
+                      "start": {
+                        "line": 16,
+                        "column": 31
+                      },
+                      "end": {
+                        "line": 16,
+                        "column": 37
+                      }
+                    }
+                  },
+                  "loc": {
+                    "start": {
+                      "line": 16,
+                      "column": 31
+                    },
+                    "end": {
+                      "line": 16,
+                      "column": 37
+                    }
+                  }
+                },
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [
+                    {
+                      "type": "ExpressionStatement",
+                      "expression": {
+                        "type": "CallExpression",
+                        "callee": {
+                          "type": "Identifier",
+                          "name": "a0",
+                          "decorators": [],
+                          "loc": {
+                            "start": {
+                              "line": 17,
+                              "column": 5
+                            },
+                            "end": {
+                              "line": 17,
+                              "column": 7
+                            }
+                          }
+                        },
+                        "arguments": [],
+                        "optional": false,
+                        "loc": {
+                          "start": {
+                            "line": 17,
+                            "column": 5
+                          },
+                          "end": {
+                            "line": 17,
+                            "column": 9
+                          }
+                        }
+                      },
+                      "loc": {
+                        "start": {
+                          "line": 17,
+                          "column": 5
+                        },
+                        "end": {
+                          "line": 17,
+                          "column": 10
+                        }
+                      }
+                    }
+                  ],
+                  "loc": {
+                    "start": {
+                      "line": 16,
+                      "column": 36
+                    },
+                    "end": {
+                      "line": 18,
+                      "column": 2
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 16,
+                    "column": 13
+                  },
+                  "end": {
+                    "line": 18,
+                    "column": 2
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 16,
+                  "column": 13
+                },
+                "end": {
+                  "line": 18,
+                  "column": 2
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 16,
+                "column": 1
+              },
+              "end": {
+                "line": 18,
+                "column": 2
+              }
+            }
+          },
+          {
+            "type": "MethodDefinition",
+            "key": {
+              "type": "Identifier",
+              "name": "main",
+              "decorators": [],
+              "loc": {
+                "start": {
+                  "line": 20,
+                  "column": 10
+                },
+                "end": {
+                  "line": 20,
+                  "column": 14
+                }
+              }
+            },
+            "kind": "method",
+            "accessibility": "public",
+            "static": true,
+            "optional": false,
+            "computed": false,
+            "value": {
+              "type": "FunctionExpression",
+              "function": {
+                "type": "ScriptFunction",
+                "id": {
+                  "type": "Identifier",
+                  "name": "main",
+                  "decorators": [],
+                  "loc": {
+                    "start": {
+                      "line": 20,
+                      "column": 10
+                    },
+                    "end": {
+                      "line": 20,
+                      "column": 14
+                    }
+                  }
+                },
+                "generator": false,
+                "async": false,
+                "expression": false,
+                "params": [],
+                "returnType": {
+                  "type": "ETSTypeReference",
+                  "part": {
+                    "type": "ETSTypeReferencePart",
+                    "name": {
+                      "type": "Identifier",
+                      "name": "void",
+                      "decorators": [],
+                      "loc": {
+                        "start": {
+                          "line": 20,
+                          "column": 18
+                        },
+                        "end": {
+                          "line": 20,
+                          "column": 22
+                        }
+                      }
+                    },
+                    "loc": {
+                      "start": {
+                        "line": 20,
+                        "column": 18
+                      },
+                      "end": {
+                        "line": 20,
+                        "column": 24
+                      }
+                    }
+                  },
+                  "loc": {
+                    "start": {
+                      "line": 20,
+                      "column": 18
+                    },
+                    "end": {
+                      "line": 20,
+                      "column": 24
+                    }
+                  }
+                },
+                "body": {
+                  "type": "BlockStatement",
+                  "statements": [
+                    {
+                      "type": "ExpressionStatement",
+                      "expression": {
+                        "type": "CallExpression",
+                        "callee": {
+                          "type": "Identifier",
+                          "name": "foo",
+                          "decorators": [],
+                          "loc": {
+                            "start": {
+                              "line": 21,
+                              "column": 5
+                            },
+                            "end": {
+                              "line": 21,
+                              "column": 8
+                            }
+                          }
+                        },
+                        "arguments": [],
+                        "optional": false,
+                        "loc": {
+                          "start": {
+                            "line": 21,
+                            "column": 5
+                          },
+                          "end": {
+                            "line": 21,
+                            "column": 10
+                          }
+                        }
+                      },
+                      "loc": {
+                        "start": {
+                          "line": 21,
+                          "column": 5
+                        },
+                        "end": {
+                          "line": 21,
+                          "column": 10
+                        }
+                      }
+                    }
+                  ],
+                  "loc": {
+                    "start": {
+                      "line": 20,
+                      "column": 23
+                    },
+                    "end": {
+                      "line": 28,
+                      "column": 2
+                    }
+                  }
+                },
+                "loc": {
+                  "start": {
+                    "line": 20,
+                    "column": 14
+                  },
+                  "end": {
+                    "line": 28,
+                    "column": 2
+                  }
+                }
+              },
+              "loc": {
+                "start": {
+                  "line": 20,
+                  "column": 14
+                },
+                "end": {
+                  "line": 28,
+                  "column": 2
+                }
+              }
+            },
+            "overloads": [],
+            "decorators": [],
+            "loc": {
+              "start": {
+                "line": 20,
+                "column": 1
+              },
+              "end": {
+                "line": 28,
+                "column": 2
+              }
+            }
+          }
+        ],
+        "loc": {
+          "start": {
+            "line": 1,
+            "column": 1
+          },
+          "end": {
+            "line": 1,
+            "column": 1
+          }
+        }
+      },
+      "loc": {
+        "start": {
+          "line": 1,
+          "column": 1
+        },
+        "end": {
+          "line": 1,
+          "column": 1
+        }
+      }
+    }
+  ],
+  "loc": {
+    "start": {
+      "line": 1,
+      "column": 1
+    },
+    "end": {
+      "line": 29,
+      "column": 1
+    }
+  }
+}
diff --git a/ets2panda/test/runtime/ets/local-class-capture-boxing.ets b/ets2panda/test/runtime/ets/local-class-capture-boxing.ets
new file mode 100644
index 0000000000..229e73d411
--- /dev/null
+++ b/ets2panda/test/runtime/ets/local-class-capture-boxing.ets
@@ -0,0 +1,218 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class UserClassType
+{
+    v : int = 0;
+    constructor (p : int)
+    {
+        this.v = p;
+    }
+
+    override toString() : string {
+        return Int.valueOf(this.v).toString();
+    }
+}
+
+enum UserEnumType 
+{ 
+    Red, 
+    Green, 
+    Blue
+};
+
+let g_array : int [] = [1,2,3];
+let g_array2 : int [] = [11,12,13];
+let g_Array : Array<Int> = new Array<Int>(new Int(4), new Int(5), new Int(6));
+let g_Array2 : Array<Int> = new Array<Int>(new Int(14), new Int(15), new Int(16));
+let g_Object : Object = new Object();
+let g_Object2 : Object = new Object();
+let g_Class : UserClassType = new UserClassType(25);
+let g_Class2 : UserClassType = new UserClassType(250);
+
+
+
+class GlobalClass
+{
+    static s_field : int = 13;
+    field : int = 14;
+
+    static s_method_boxing_local_class() {
+        // predefined value types
+        let l_number : number = 1;
+        let l_byte : byte = 2;
+        let l_short : short = 3;
+        let l_int : int = 4;
+        let l_long : long = 5;
+        let l_float : float = 6.0;
+        let l_double : double = 7.0;
+        let l_boolean : boolean = false;
+        let l_char : char = c'x';
+        
+        // user defined value types
+        let l_enum : UserEnumType = UserEnumType.Red;
+
+        // predefined reference types
+        let l_Number : Number = new Number(11);
+        let l_Byte : Byte = new Byte(12 as byte);
+        let l_Short : Short = new Short(13 as short);
+        let l_Int : Int = new Int(14 as int);
+        let l_Long : Long = new Long(15 as long);
+        let l_Float : Float = new Float(16.0);
+        let l_Double : Double = new Double(17.0);
+        let l_Boolean: Boolean = new Boolean(false);
+        let l_Char : Char = new Char(c'X');
+
+        let l_string : string = "something";
+        let l_String : String = new String("Something");
+        let l_array : int [] = g_array;
+        let l_Array : Array<Int> = g_Array;
+        //let l_bigint : bigint = 20n;
+        //let l_BigInt : BigInt = new BigInt(21n);
+        let l_Object : Object = g_Object;
+
+        // user defined reference types
+        let l_Class : UserClassType = g_Class;
+
+        class LocalClassBoxing
+        {
+            local_field : int = 1000;
+            static local_s_field : int = 2000;
+
+            static local_s_method(lp : int) : void 
+            {
+                assert(lp == 300);
+                assert(LocalClassBoxing.local_s_field == 2000);
+
+                LocalClassBoxing.local_s_field = 5000;
+                assert(LocalClassBoxing.local_s_field == 5000);
+            } 
+
+            local_method(lp : int) : void 
+            {
+                // Parameter
+                assert(lp == 400);
+                // Local class object field
+                assert(this.local_field == 1000);
+                // Local class static field
+                assert(LocalClassBoxing.local_s_field == 5000);
+                // Outer class static field
+                assert(GlobalClass.s_field == 13);
+                // Predefined value types
+                assert(l_number == 1);
+                assert(l_byte == 2);
+                assert(l_short == 3);
+                assert(l_int == 4);
+                assert(l_long == 5);
+                assert(l_float == 6);
+                assert(l_double == 7);
+                assert(l_boolean == false);
+                assert(l_char == c'x');
+                // User defined value type
+                assert(l_enum == UserEnumType.Red);
+                // Predefined reference types
+                assert(l_Number == Number.valueOf(11));
+                assert(l_Byte == Byte.valueOf(12 as byte));
+                assert(l_Short == Short.valueOf(13 as short));
+                assert(l_Int == Int.valueOf(14 as int));
+                assert(l_Long == Long.valueOf(15 as long));
+                assert(l_Float == Float.valueOf(16 as float));
+                assert(l_Double == Double.valueOf(17 as double));
+                assert(l_Boolean == Boolean.valueOf(false));
+                assert(l_Char == Char.valueOf(c'X'));
+                assert(l_string == "something");
+                assert(l_String == "Something");
+                // assert(l_array == g_array);
+                // assert(l_Array == g_Array);
+                assert(l_Object == g_Object);
+                assert(l_Class == g_Class);
+
+                this.local_field = 1100;
+                LocalClassBoxing.local_s_field = 5100;
+
+                l_number = 101;
+                l_byte = 102;
+                l_short = 103;
+                l_int = 104;
+                l_long = 105;
+                l_float = 106.0;
+                l_double = 107.0;
+                l_boolean = true;
+                l_char = c'y';
+                //l_enum = UserEnumType.Green;
+
+                l_Number = new Number(111);
+                l_Byte = new Byte(112 as byte);
+                l_Short = new Short(113 as short);
+                l_Int = new Int(114 as int);
+                l_Long = new Long(115 as long);
+                l_Float = new Float(116.0);
+                l_Double = new Double(117.0);
+                l_Boolean = new Boolean(true);
+                l_Char = new Char(c'Y');
+
+                l_string = "something new";
+                l_String = new String("Something new");
+                l_array = g_array2;
+                l_Array = g_Array2;
+                l_Object = g_Object2;
+                l_Class = g_Class2;
+            }
+        };
+        LocalClassBoxing.local_s_field = 2000;  // due to the jit loop
+        LocalClassBoxing.local_s_method(300);
+
+        let lcb = new LocalClassBoxing();
+        lcb.local_method(400);        
+
+        assert(lcb.local_field == 1100);
+        assert(LocalClassBoxing.local_s_field == 5100);
+        assert(l_number == 101);
+        assert(l_byte == 102);
+        assert(l_short == 103);
+        assert(l_int == 104);
+        assert(l_long == 105);
+        assert(l_float == 106);
+        assert(l_double == 107);
+        assert(l_boolean == true);
+        assert(l_char == c'y');
+        
+        //assert(l_enum == UserEnumType.Green);
+        
+        // Predefined reference types
+        assert(l_Number == Number.valueOf(111));
+        assert(l_Byte == Byte.valueOf(112 as byte));
+        assert(l_Short == Short.valueOf(113 as short));
+        assert(l_Int == Int.valueOf(114 as int));
+        assert(l_Long == Long.valueOf(115 as long));
+        assert(l_Float == Float.valueOf(116 as float));
+        assert(l_Double == Double.valueOf(117 as double));
+        assert(l_Boolean == Boolean.valueOf(true));
+        assert(l_Char == Char.valueOf(c'Y'));
+        assert(l_string == "something new");
+        assert(l_String == "Something new");
+        //assert(l_array == g_array2);
+        //assert(l_Array == g_Array2);
+        assert(l_Object == g_Object2);
+        assert(l_Class == g_Class2);
+    }
+}
+
+
+function main() : int
+{
+    GlobalClass.s_method_boxing_local_class();
+    return 0;
+}
diff --git a/ets2panda/test/runtime/ets/local-class-capture-not-boxing.ets b/ets2panda/test/runtime/ets/local-class-capture-not-boxing.ets
new file mode 100644
index 0000000000..38c95a41fd
--- /dev/null
+++ b/ets2panda/test/runtime/ets/local-class-capture-not-boxing.ets
@@ -0,0 +1,151 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class UserClassType
+{
+    v : int = 0;
+    constructor (p : int)
+    {
+        this.v = p;
+    }
+
+    override toString() : string {
+        return Int.valueOf(this.v).toString();
+    }
+}
+
+enum UserEnumType 
+{ 
+    Red, 
+    Green, 
+    Blue
+};
+
+let g_array : int [] = [1,2,3];
+let g_array2 : int [] = [11,12,13];
+let g_Array : Array<Int> = new Array<Int>(new Int(4), new Int(5), new Int(6));
+let g_Array2 : Array<Int> = new Array<Int>(new Int(14), new Int(15), new Int(16));
+let g_Object : Object = new Object();
+let g_Object2 : Object = new Object();
+let g_Class : UserClassType = new UserClassType(25);
+let g_Class2 : UserClassType = new UserClassType(250);
+
+
+
+class GlobalClass
+{
+    static s_field : int = 13;
+    field : int = 14;
+
+    static s_method_not_boxing_local_class() {
+        // predefined value types
+        let l_number : number = 1;
+        let l_byte : byte = 2;
+        let l_short : short = 3;
+        let l_int : int = 4;
+        let l_long : long = 5;
+        let l_float : float = 6.0;
+        let l_double : double = 7.0;
+        let l_boolean : boolean = false;
+        let l_char : char = c'x';
+        
+        // user defined value types
+        let l_enum : UserEnumType = UserEnumType.Red;
+
+        // predefined reference types
+        let l_Number : Number = new Number(11);
+        let l_Byte : Byte = new Byte(12 as byte);
+        let l_Short : Short = new Short(13 as short);
+        let l_Int : Int = new Int(14 as int);
+        let l_Long : Long = new Long(15 as long);
+        let l_Float : Float = new Float(16.0);
+        let l_Double : Double = new Double(17.0);
+        let l_Boolean: Boolean = new Boolean(false);
+        let l_Char : Char = new Char(c'X');
+
+        let l_string : string = "something";
+        let l_String : String = new String("Something");
+        let l_array : int [] = g_array;
+        let l_Array : Array<Int> = g_Array;
+        //let l_bigint : bigint = 20n;
+        //let l_BigInt : BigInt = new BigInt(21n);
+        let l_Object : Object = g_Object;
+
+        // user defined reference types
+        let l_Class : UserClassType = g_Class;
+
+        class LocalClassNotBoxing
+        {
+            local_field : int = 100;
+            static local_s_field : int = 200;
+
+            static local_s_method(lp : int) : void 
+            {
+                assert(lp == 30);
+                assert(LocalClassNotBoxing.local_s_field == 200);
+            } 
+
+            local_method(lp : int) : void 
+            {
+                // Parameter
+                assert(lp == 40);
+                // Local class object field
+                assert(this.local_field == 100);
+                // Local class static field
+                assert(LocalClassNotBoxing.local_s_field == 200);
+                // Predefined value types
+                assert(l_number == 1);
+                assert(l_byte == 2);
+                assert(l_short == 3);
+                assert(l_int == 4);
+                assert(l_long == 5);
+                assert(l_float == 6);
+                assert(l_double == 7);
+                assert(l_boolean == false);
+                assert(l_char == c'x');
+                // User defined value type
+                assert(l_enum == UserEnumType.Red);
+                // Predefined reference types
+                assert(l_Number == Number.valueOf(11));
+                assert(l_Byte == Byte.valueOf(12 as byte));
+                assert(l_Short == Short.valueOf(13 as short));
+                assert(l_Int == Int.valueOf(14 as int));
+                assert(l_Long == Long.valueOf(15 as long));
+                assert(l_Float == Float.valueOf(16 as float));
+                assert(l_Double == Double.valueOf(17 as double));
+                assert(l_Boolean == Boolean.valueOf(false));
+                assert(l_Char == Char.valueOf(c'X'));
+                assert(l_string == "something");
+                assert(l_String == "Something");
+                assert(l_array == g_array);
+                assert(l_Array == g_Array);
+                assert(l_Object == g_Object);
+                assert(l_Class == g_Class);
+            }
+        };
+
+        LocalClassNotBoxing.local_s_method(30);
+
+        let lc = new LocalClassNotBoxing();
+        lc.local_method(40);
+    }
+}
+
+
+function main() : int
+{
+    GlobalClass.s_method_not_boxing_local_class();
+    return 0;
+}
diff --git a/ets2panda/test/runtime/ets/local-class-capture-parameter.ets b/ets2panda/test/runtime/ets/local-class-capture-parameter.ets
new file mode 100644
index 0000000000..048ee9ee37
--- /dev/null
+++ b/ets2panda/test/runtime/ets/local-class-capture-parameter.ets
@@ -0,0 +1,39 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+
+class GlobalClass
+{
+    static capture_param_method(param : int)
+    {
+        class LocalClass
+        {
+            method()
+            {
+                assert(param == 1)
+            }
+        }
+
+        let lc = new LocalClass();
+        lc.method()
+    }
+}
+
+function main() : int
+{
+    GlobalClass.capture_param_method(1);
+
+    return 0;
+}
diff --git a/ets2panda/test/runtime/ets/local-class-in-local-class.ets b/ets2panda/test/runtime/ets/local-class-in-local-class.ets
new file mode 100644
index 0000000000..274c8dc669
--- /dev/null
+++ b/ets2panda/test/runtime/ets/local-class-in-local-class.ets
@@ -0,0 +1,54 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+
+function main() : int
+{
+    let l_int = 0;
+
+    class LocalClassLevel1
+    {
+        m_int1 = 11;
+
+        method1()
+        {
+            let l_int2 = 12;
+            assert(this.m_int1 == 11);
+            assert(l_int == 0);
+            l_int = 1;
+
+            class LocalClassLevel2
+            {
+                m_int2 : int = 22;
+
+                method2() {
+                    assert(this.m_int2 == 22);
+                    assert(l_int2 == 12);
+                    l_int2 = 13;
+                }
+            }
+
+            let lcl2 = new LocalClassLevel2();
+            lcl2.method2();
+            assert(l_int2 == 13)
+        }
+    }
+
+    let lcl1 = new LocalClassLevel1();
+    lcl1.method1();
+    assert(l_int == 1);
+
+    return 0;
+}
diff --git a/ets2panda/test/runtime/ets/local-class-mixed-capture.ets b/ets2panda/test/runtime/ets/local-class-mixed-capture.ets
new file mode 100644
index 0000000000..c23219be11
--- /dev/null
+++ b/ets2panda/test/runtime/ets/local-class-mixed-capture.ets
@@ -0,0 +1,46 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function main() : int
+{
+    // Since the BoxingLocalClass modifies the 'i' it has to be boxed and use it as a boxed 
+    // variable in the NotBoxingLocalClass too
+    let i : int = 1;
+
+    class NotBoxingLocalClass
+    {
+        local_method()
+        {
+            assert(i == 1);
+        }
+    }
+
+    class BoxingLocalClass
+    {
+        local_method()
+        {
+            assert(i == 1)
+            i = 2;
+        }
+    }
+
+    let nblc = new NotBoxingLocalClass();
+    nblc.local_method();
+
+    let blc = new BoxingLocalClass();
+    blc.local_method();
+    assert(i == 2);
+    return 0;
+}
diff --git a/ets2panda/test/runtime/ets/local-class-modify-captured-parameter.ets b/ets2panda/test/runtime/ets/local-class-modify-captured-parameter.ets
new file mode 100644
index 0000000000..d4c1565317
--- /dev/null
+++ b/ets2panda/test/runtime/ets/local-class-modify-captured-parameter.ets
@@ -0,0 +1,41 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+
+class GlobalClass
+{
+    static capture_param_method(param : int)
+    {
+        class LocalClass
+        {
+            method()
+            {
+                assert(param == 1)
+                param = 3;
+            }
+        }
+
+        let lc = new LocalClass();
+        lc.method()
+        assert(param == 3);
+    }
+}
+
+function main() : int
+{
+    GlobalClass.capture_param_method(1);
+
+    return 0;
+}
diff --git a/ets2panda/test/runtime/ets/local-class-standard-example1.ets b/ets2panda/test/runtime/ets/local-class-standard-example1.ets
new file mode 100644
index 0000000000..eb561768ec
--- /dev/null
+++ b/ets2panda/test/runtime/ets/local-class-standard-example1.ets
@@ -0,0 +1,49 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+function foo (parameter: number) {
+    let local: string = "function local";
+    interface LocalInterface { // Local interface in a top-level function
+        method (): void;   // It has a method
+        field: string;     // and a property
+    }
+    class LocalClass implements LocalInterface { // Class implements interface
+        // Local class in a top-level function
+        override method () { 
+            console.log ("Instance field = " + this.field + " par = " + parameter  + " loc = " +  local )
+            assert(this.field == "`instance field value`")
+            assert(parameter == 42)
+            assert(local == "function local")
+        }
+        field: string = "`instance field value`"
+        static s_method () { 
+            console.log ("Static field = " + LocalClass.s_field) 
+            assert(LocalClass.s_field == "`class/static field value`")
+
+        }
+        static s_field: string = "`class/static field value`"
+    }
+
+    let lc: LocalInterface = new LocalClass();
+    // Both local types can be freely used in the top-level function scope
+    lc.method()
+    LocalClass.s_method()
+}
+
+function main() : int
+{
+    foo(42);
+    return 0;
+}
diff --git a/ets2panda/test/runtime/ets/local-class-standard-example2.ets b/ets2panda/test/runtime/ets/local-class-standard-example2.ets
new file mode 100644
index 0000000000..de257c768d
--- /dev/null
+++ b/ets2panda/test/runtime/ets/local-class-standard-example2.ets
@@ -0,0 +1,82 @@
+/*
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class A_class {
+    field: number = 1234 // Not visible for the local class
+    method (parameter: number) {
+        let local: string = "instance local"
+        
+        interface LocalInterface {
+            method (): void
+            field: string
+        }
+    
+        class LocalClass implements LocalInterface {
+            override method () { 
+                console.log ("Instance field = " + this.field + " par = " + parameter + " loc = " +  local ) 
+                assert(this.field == "`instance method instance field value`")
+                assert(parameter == 42)
+                assert(local == "instance local")
+
+            }
+            field: string = "`instance method instance field value`"
+            static s_method () { 
+                console.log ("Static field = " + LocalClass.s_field)
+                assert(LocalClass.s_field == "`instance method class/static field value`")
+            }
+            static s_field: string = "`instance method class/static field value`"
+        }
+        
+        let lc: LocalInterface = new LocalClass
+        lc.method()
+        LocalClass.s_method()
+    }
+    
+    static s_method (parameter: number) {
+        let local: string = "class/static local"
+        interface LocalInterface {
+            method (): void
+            field: string
+        }
+
+        class LocalClass implements LocalInterface {
+            override method () { 
+                console.log ("Instance field = " + this.field + " par = " + parameter + " loc = " +  local) 
+                assert(this.field == "`static method instance field value`")
+                assert(parameter == 72)
+                assert(local == "class/static local")
+            }
+            field: string = "`static method instance field value`"
+            static s_method () { 
+                console.log ("Static field = " + LocalClass.s_field) 
+                assert(LocalClass.s_field == "`static method class/static field value`")
+            }
+            static s_field: string = "`static method class/static field value`"
+        }
+        let lc: LocalInterface = new LocalClass
+        lc.method()
+        LocalClass.s_method()
+    }
+}
+
+function main() : int
+{
+    A_class.s_method(72);
+
+    let a = new A_class();
+    a.method(42)
+
+    return 0;
+}
diff --git a/ets2panda/test/test-lists/ets-runtime/ets-runtime-ignored.txt b/ets2panda/test/test-lists/ets-runtime/ets-runtime-ignored.txt
index c12cc9299c..7b6b2e0d97 100644
--- a/ets2panda/test/test-lists/ets-runtime/ets-runtime-ignored.txt
+++ b/ets2panda/test/test-lists/ets-runtime/ets-runtime-ignored.txt
@@ -56,3 +56,7 @@ lambdaExpressionWithRestParameter.ets
 
 # Non-trivial cast sequence
 castSequence.ets
+
+# ignored due to interface implementation modification
+local-class-standard-example1.ets 
+local-class-standard-example2.ets
diff --git a/ets2panda/varbinder/ETSBinder.cpp b/ets2panda/varbinder/ETSBinder.cpp
index e927733cc3..e7d82c710a 100644
--- a/ets2panda/varbinder/ETSBinder.cpp
+++ b/ets2panda/varbinder/ETSBinder.cpp
@@ -181,7 +181,7 @@ void ETSBinder::LookupIdentReference(ir::Identifier *ident)
         auto *outerFunction = GetScope()->EnclosingVariableScope()->Node();
 
         if ((!outerFunction->IsScriptFunction() || !outerFunction->AsScriptFunction()->IsArrow()) &&
-            !res.variable->IsGlobalVariable() && res.level > 1) {
+            !res.variable->IsGlobalVariable() && res.variable->HasFlag(VariableFlags::LOCAL) && res.level > 1) {
             ThrowInvalidCapture(ident->Start(), name);
         }
     }
diff --git a/ets2panda/varbinder/recordTable.cpp b/ets2panda/varbinder/recordTable.cpp
index 971257b12c..917107de71 100644
--- a/ets2panda/varbinder/recordTable.cpp
+++ b/ets2panda/varbinder/recordTable.cpp
@@ -1,5 +1,5 @@
 /*
- * Copyright (c) 2021 Huawei Device Co., Ltd.
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
  * You may obtain a copy of the License at
@@ -20,11 +20,15 @@
 #include "ir/expressions/identifier.h"
 #include "ir/ts/tsEnumDeclaration.h"
 #include "ir/ts/tsInterfaceDeclaration.h"
+#include "checker/types/ets/etsObjectType.h"
 #include "generated/signatures.h"
 
 namespace ark::es2panda::varbinder {
 BoundContext::BoundContext(RecordTable *recordTable, ir::ClassDefinition *classDef)
-    : prev_(recordTable->boundCtx_), recordTable_(recordTable), savedRecord_(recordTable->record_)
+    : prev_(recordTable->boundCtx_),
+      recordTable_(recordTable),
+      currentRecord_(classDef),
+      savedRecord_(recordTable->record_)
 {
     if (classDef == nullptr || !recordTable_->classDefinitions_.insert(classDef).second) {
         return;
@@ -37,7 +41,10 @@ BoundContext::BoundContext(RecordTable *recordTable, ir::ClassDefinition *classD
 }
 
 BoundContext::BoundContext(RecordTable *recordTable, ir::TSInterfaceDeclaration *interfaceDecl)
-    : prev_(recordTable->boundCtx_), recordTable_(recordTable), savedRecord_(recordTable->record_)
+    : prev_(recordTable->boundCtx_),
+      recordTable_(recordTable),
+      currentRecord_(interfaceDecl),
+      savedRecord_(recordTable->record_)
 {
     if (interfaceDecl == nullptr || !recordTable_->interfaceDeclarations_.insert(interfaceDecl).second) {
         return;
@@ -73,6 +80,13 @@ util::StringView BoundContext::FormRecordName() const
     util::UString recordName(recordTable_->program_->Allocator());
     recordName.Append(prev_->FormRecordName());
     recordName.Append(compiler::Signatures::METHOD_SEPARATOR);
+    if (std::holds_alternative<ir::ClassDefinition *>(currentRecord_)) {
+        const auto *classDef = std::get<ir::ClassDefinition *>(currentRecord_);
+        if (classDef->IsLocal()) {
+            recordName.Append(classDef->LocalPrefix());
+        }
+    }
+
     recordName.Append(recordIdent_->Name());
     return recordName.View();
 }
diff --git a/ets2panda/varbinder/recordTable.h b/ets2panda/varbinder/recordTable.h
index 1576acf0c7..9486719379 100644
--- a/ets2panda/varbinder/recordTable.h
+++ b/ets2panda/varbinder/recordTable.h
@@ -1,5 +1,5 @@
 /*
- * Copyright (c) 2021 Huawei Device Co., Ltd.
+ * Copyright (c) 2021-2024 Huawei Device Co., Ltd.
  * Licensed under the Apache License, Version 2.0 (the "License");
  * you may not use this file except in compliance with the License.
  * You may obtain a copy of the License at
@@ -180,6 +180,7 @@ public:
 private:
     BoundContext *prev_;
     RecordTable *recordTable_;
+    RecordTable::RecordHolder currentRecord_ {nullptr};
     RecordTable::RecordHolder savedRecord_ {nullptr};
     ir::Identifier *recordIdent_ {nullptr};
 };
diff --git a/ets2panda/varbinder/scope.cpp b/ets2panda/varbinder/scope.cpp
index bba9cd848e..d6bb722e42 100644
--- a/ets2panda/varbinder/scope.cpp
+++ b/ets2panda/varbinder/scope.cpp
@@ -73,6 +73,38 @@ const VariableScope *Scope::EnclosingVariableScope() const
     return nullptr;
 }
 
+// NOTE(psiket): Duplication
+ClassScope *Scope::EnclosingClassScope()
+{
+    Scope *iter = this;
+
+    while (iter != nullptr) {
+        if (iter->IsClassScope()) {
+            return iter->AsClassScope();
+        }
+
+        iter = iter->Parent();
+    }
+
+    return nullptr;
+}
+
+const ClassScope *Scope::EnclosingClassScope() const
+{
+    const auto *iter = this;
+
+    while (iter != nullptr) {
+        if (iter->IsVariableScope()) {
+            return iter->AsClassScope();
+        }
+
+        iter = iter->Parent();
+    }
+
+    return nullptr;
+}
+
+// NOLINTNEXTLINE(google-default-arguments)
 Variable *Scope::FindLocal(const util::StringView &name, ResolveBindingOptions options) const
 {
     if ((options & ResolveBindingOptions::INTERFACES) != 0) {
@@ -147,14 +179,16 @@ ConstScopeFindResult Scope::FindInGlobal(const util::StringView &name, const Res
 ConstScopeFindResult Scope::FindInFunctionScope(const util::StringView &name, const ResolveBindingOptions options) const
 {
     const auto *scopeIter = this;
-    while (scopeIter != nullptr && !scopeIter->IsClassScope() && !scopeIter->IsGlobalScope()) {
-        if (auto *const resolved = scopeIter->FindLocal(name, options); resolved != nullptr) {
-            return {name, scopeIter, 0, 0, resolved};
+    while (scopeIter != nullptr && !scopeIter->IsGlobalScope()) {
+        if (!scopeIter->IsClassScope()) {
+            if (auto *const resolved = scopeIter->FindLocal(name, options); resolved != nullptr) {
+                return ConstScopeFindResult(name, scopeIter, 0, 0, resolved);
+            }
         }
         scopeIter = scopeIter->Parent();
     }
 
-    return {name, scopeIter, 0, 0, nullptr};
+    return ConstScopeFindResult(name, scopeIter, 0, 0, nullptr);
 }
 
 ScopeFindResult Scope::Find(const util::StringView &name, const ResolveBindingOptions options)
@@ -236,6 +270,10 @@ Variable *Scope::AddLocal(ArenaAllocator *allocator, Variable *currentVariable,
             return bindings_.insert({newDecl->Name(), allocator->New<LocalVariable>(newDecl, VariableFlags::INTERFACE)})
                 .first->second;
         }
+        case DeclType::CLASS: {
+            return bindings_.insert({newDecl->Name(), allocator->New<LocalVariable>(newDecl, VariableFlags::CLASS)})
+                .first->second;
+        }
         case DeclType::TYPE_PARAMETER: {
             return bindings_
                 .insert({newDecl->Name(), allocator->New<LocalVariable>(newDecl, VariableFlags::TYPE_PARAMETER)})
@@ -404,8 +442,40 @@ Variable *FunctionScope::AddBinding(ArenaAllocator *allocator, Variable *current
         case DeclType::ENUM_LITERAL: {
             return AddTSBinding<LocalVariable>(allocator, currentVariable, newDecl, VariableFlags::ENUM_LITERAL);
         }
+        // NOTE(psiket):Duplication
         case DeclType::INTERFACE: {
-            return AddTSBinding<LocalVariable>(allocator, currentVariable, newDecl, VariableFlags::INTERFACE);
+            ir::Identifier *ident {};
+            ident = newDecl->Node()->AsTSInterfaceDeclaration()->Id();
+
+            auto *var = InsertBinding(newDecl->Name(), allocator->New<LocalVariable>(newDecl, VariableFlags::INTERFACE))
+                            .first->second;
+
+            if (var == nullptr) {
+                return nullptr;
+            }
+
+            var->SetScope(this);
+            if (ident != nullptr) {
+                ident->SetVariable(var);
+            }
+            return var;
+        }
+        case DeclType::CLASS: {
+            ir::Identifier *ident {};
+            ident = newDecl->Node()->AsClassDefinition()->Ident();
+
+            auto *var = InsertBinding(newDecl->Name(), allocator->New<LocalVariable>(newDecl, VariableFlags::CLASS))
+                            .first->second;
+
+            if (var == nullptr) {
+                return nullptr;
+            }
+
+            var->SetScope(this);
+            if (ident != nullptr) {
+                ident->SetVariable(var);
+            }
+            return var;
         }
         default: {
             return AddLexical<LocalVariable>(allocator, currentVariable, newDecl);
diff --git a/ets2panda/varbinder/scope.h b/ets2panda/varbinder/scope.h
index b179f00b2b..0aa277b0b4 100644
--- a/ets2panda/varbinder/scope.h
+++ b/ets2panda/varbinder/scope.h
@@ -134,6 +134,9 @@ public:
 
     const VariableScope *EnclosingVariableScope() const;
 
+    ClassScope *EnclosingClassScope();
+    const ClassScope *EnclosingClassScope() const;
+
     void AddFlag(ScopeFlags flag)
     {
         flags_ |= flag;
-- 
Gitee